pycom14g13010

Polysaccharide biosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
OG0014552
Physical Location & Seq
Forward (+)
16040896 .. 16041114
219 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGTCATCAATCTATTCTGCTAGTATGATAGCAAGAAAAGCAAACATTACGCATGTGGTAGTGCATGACGTAGATCGAATGATCGAGAAGTGGTTTTCCTGGGAGTTTCTGTGTGATGAGAACTTAGTTTCTTCAAAAGGGAGATTATGGAACTTTAGGATCACAGGCCAATTAAACTCTACAAATTTTTGCCCTGCCAAAGGGATTACAATAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Polysacc_synt_4

Protein Analysis

73

Amino Acids

8.29

Weight (kDa)

7.83

Isoelectric Point (pI)

38.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
IRX15_IRX15L_GXM PF21729 1 - 52 1.2e-17 IRX15/IRX15L/GXM
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014552)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G24910
fragaria_vesca FvH4_5g08380
malus_domestica MD06G1141300.v1.1 MD14G1156500.v1.1
prunus_persica Prupe.5G150600_v2.0.a1
pyrus_communis pycom06g13130 pycom14g13010
rosa_chinensis RchiOBHm_Chr7g0190071
rosa_laevigata RLG00000004567
rosa_multiflora Rmu_sc0004886.1_g000008
rosa_roxburghii Rroxscaffold_3G00264910
rosa_rugosa Rorug06G0502200
rosa_samantha Rh7AG107800 Rh7BG110100 Rh7CG112300 Rh7DG110700
rosa_wichuraiana Rw7G009300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 167
AcsI RAATTY 1 cut(s) 184
AfiI CCNNNNNNNGG 1 cut(s) 200
AgsI TTSAA 1 cut(s) 135
AjnI CCWGG 1 cut(s) 98
AlwI GGATC 1 cut(s) 167
AoxI GGCC 1 cut(s) 166
ApoI RAATTY 1 cut(s) 184
BciT130I CCWGG 1 cut(s) 100
BfaI CTAG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 99
BsaXI ACNNNNNCTCC 2 cut(s) 95, 125
Bsc4I CCNNNNNNNGG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 200
BshFI GGCC 1 cut(s) 168
BslI CCNNNNNNNGG 1 cut(s) 200
BsnI GGCC 1 cut(s) 168
Bsp143I GATC 3 cut(s) 73, 81, 159
BspANI GGCC 1 cut(s) 168
BspPI GGATC 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 3 cut(s) 73, 81, 159
Bst2UI CCWGG 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 124
BstENI CCTNNNNNAGG 1 cut(s) 198
BstKTI GATC 3 cut(s) 76, 84, 162
BstMBI GATC 3 cut(s) 73, 81, 159
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 100
BstNSI RCATGY 1 cut(s) 56
BstSCI CCNGG 1 cut(s) 98
BsuRI GGCC 1 cut(s) 168
CviAII CATG 2 cut(s) 53, 65
CviJI RGCY 1 cut(s) 168
CviKI_1 RGCY 1 cut(s) 168
DdeI CTNAG 1 cut(s) 124
DpnI GATC 3 cut(s) 75, 83, 161
DpnII GATC 3 cut(s) 73, 81, 159
EcoNI CCTNNNNNAGG 1 cut(s) 198
EcoRII CCWGG 1 cut(s) 98
FaeI CATG 2 cut(s) 56, 68
FaiI YATR 4 cut(s) 26, 54, 66, 148
FatI CATG 2 cut(s) 52, 64
FspBI CTAG 1 cut(s) 21
HaeIII GGCC 1 cut(s) 168
Hin1II CATG 2 cut(s) 56, 68
Hpy188III TCNNGA 1 cut(s) 85
HpyCH4IV ACGT 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 124
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 2 cut(s) 56, 68
Kzo9I GATC 3 cut(s) 73, 81, 159
LpnPI CCDG 4 cut(s) 85, 112, 150, 207
MaeI CTAG 1 cut(s) 21
MaeII ACGT 1 cut(s) 69
MalI GATC 3 cut(s) 75, 83, 161
MboI GATC 3 cut(s) 73, 81, 159
MboII GAAGA 1 cut(s) 123
MluCI AATT 2 cut(s) 170, 184
MseI TTAA 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 3 cut(s) 73, 81, 159
NlaIII CATG 2 cut(s) 56, 68
NspI RCATGY 1 cut(s) 56
Psp6I CCWGG 1 cut(s) 98
PspGI CCWGG 1 cut(s) 98
SaqAI TTAA 1 cut(s) 173
Sau3AI GATC 3 cut(s) 73, 81, 159
ScrFI CCNGG 1 cut(s) 100
SetI ASST 1 cut(s) 72
SgeI CNNG 9 cut(s) 33, 45, 65, 77, 97, 111, 112, 177, 206
Sse9I AATT 2 cut(s) 170, 184
SspMI CTAG 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 98
TaiI ACGT 1 cut(s) 72
TaqI TCGA 2 cut(s) 76, 84
TasI AATT 2 cut(s) 170, 184
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
XagI CCTNNNNNAGG 1 cut(s) 198
XapI RAATTY 1 cut(s) 184
XceI RCATGY 1 cut(s) 56
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.