pycom14g14990

dof zinc finger protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
17658118 .. 17658537
420 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 420 bp
ATGAACCAACACCACCACCCCGGATCATCTTCGTCGTCGATATCTCACATCCCAACTGATCTCCACCTTTCTTTTCCTGATCAGATGCAGTTCTCACACCTCAATAACTTGATGCTTGGAAGTAATATGAACCCTAGTAGCTTCATGGACAATAGTAACCCTAGACCGATTGATTTCATGGAGAGCAAGTTGGAGGCTATAGTGGAGAATGCCAGGAACTATGATTTCATGGGGGGTGGTGCTGATTTGGGTATGATGGGTGGATATGGAAATAATATGGGTGGAGTTAGTCATGGATTAGATCATCAGTCAAGCTTTAATGGCATTTGCTCATCTCCATTTGGGATGTCATCACTTGATGGGCAGAATGGTAATTTCATGGACAGTTGCCAGAGGTTAATGTTGCCATATGATCAATGA

Protein Analysis

140

Amino Acids

15.16

Weight (kDa)

4.99

Isoelectric Point (pI)

38.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014572)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G62940
fragaria_vesca FvH4_5g05330
malus_domestica MD06G1173600.v1.1 MD14G1180100.v1.1
prunus_persica Prupe.5G173100_v2.0.a1
pyrus_communis pycom06g15480 pycom14g14990
rosa_chinensis RchiOBHm_Chr7g0193511
rosa_laevigata RLG00000004265
rosa_multiflora Rmu_sc0006688.1_g000002
rosa_roxburghii Rroxscaffold_3G00262040
rosa_rugosa Rorug07G0009900
rosa_samantha Rh7AG136800 Rh7BG137100 Rh7CG140400 Rh7DG138200
rosa_wichuraiana Rw7G011650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 31
AjnI CCWGG 1 cut(s) 212
AluBI AGCT 2 cut(s) 141, 315
AluI AGCT 2 cut(s) 141, 315
AlwI GGATC 1 cut(s) 31
AsuC2I CCSGG 1 cut(s) 21
BccI CCATC 2 cut(s) 250, 353
BciT130I CCWGG 1 cut(s) 214
BclI TGATCA 2 cut(s) 79, 412
BcnI CCSGG 1 cut(s) 21
BfaI CTAG 2 cut(s) 135, 162
BfmI CTRYAG 1 cut(s) 198
Bme1390I CCNGG 2 cut(s) 21, 214
BmrFI CCNGG 2 cut(s) 21, 214
BmsI GCATC 2 cut(s) 75, 102
BpuMI CCSGG 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 19
BsaXI ACNNNNNCTCC 2 cut(s) 173, 203
BseBI CCWGG 1 cut(s) 214
BseDI CCNNGG 1 cut(s) 19
BseGI GGATG 2 cut(s) 48, 351
BsiSI CCGG 1 cut(s) 21
BsmI GAATGC 1 cut(s) 214
Bsp143I GATC 5 cut(s) 23, 58, 79, 301, 412
BspPI GGATC 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 19
BssMI GATC 5 cut(s) 23, 58, 79, 301, 412
Bst2UI CCWGG 1 cut(s) 214
Bst4CI ACNGT 1 cut(s) 386
BstF5I GGATG 2 cut(s) 48, 351
BstKTI GATC 5 cut(s) 26, 61, 82, 304, 415
BstMBI GATC 5 cut(s) 23, 58, 79, 301, 412
BstMWI GCNNNNNNNGC 1 cut(s) 321
BstNI CCWGG 1 cut(s) 214
BstSCI CCNGG 2 cut(s) 19, 212
BstSFI CTRYAG 1 cut(s) 198
BtsCI GGATG 2 cut(s) 48, 351
CviAII CATG 5 cut(s) 145, 178, 229, 293, 379
CviJI RGCY 3 cut(s) 141, 197, 315
CviKI_1 RGCY 3 cut(s) 141, 197, 315
DpnI GATC 5 cut(s) 25, 60, 81, 303, 414
DpnII GATC 5 cut(s) 23, 58, 79, 301, 412
Eco32I GATATC 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 212
EcoRV GATATC 1 cut(s) 42
FaeI CATG 5 cut(s) 148, 181, 232, 296, 382
FatI CATG 5 cut(s) 144, 177, 228, 292, 378
FauNDI CATATG 1 cut(s) 409
FbaI TGATCA 2 cut(s) 79, 412
FokI GGATG 2 cut(s) 35, 358
FspBI CTAG 2 cut(s) 135, 162
HapII CCGG 1 cut(s) 21
Hin1II CATG 5 cut(s) 148, 181, 232, 296, 382
HindIII AAGCTT 1 cut(s) 313
HpaII CCGG 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 77
Hpy99I CGWCG 2 cut(s) 37, 40
HpyCH4III ACNGT 1 cut(s) 386
HpyCH4V TGCA 1 cut(s) 88
HpyF10VI GCNNNNNNNGC 1 cut(s) 321
Hsp92II CATG 5 cut(s) 148, 181, 232, 296, 382
Ksp22I TGATCA 2 cut(s) 79, 412
Kzo9I GATC 5 cut(s) 23, 58, 79, 301, 412
LpnPI CCDG 5 cut(s) 34, 90, 199, 226, 404
LweI GCATC 2 cut(s) 75, 102
MaeI CTAG 2 cut(s) 135, 162
MaeIII GTNAC 1 cut(s) 155
MalI GATC 5 cut(s) 25, 60, 81, 303, 414
MboI GATC 5 cut(s) 23, 58, 79, 301, 412
MboII GAAGA 1 cut(s) 21
MluCI AATT 1 cut(s) 373
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 3 cut(s) 110, 187, 387
MseI TTAA 2 cut(s) 318, 398
MspI CCGG 1 cut(s) 21
MspR9I CCNGG 2 cut(s) 21, 214
Mva1269I GAATGC 1 cut(s) 214
MvaI CCWGG 1 cut(s) 214
MwoI GCNNNNNNNGC 1 cut(s) 321
NciI CCSGG 1 cut(s) 21
NdeI CATATG 1 cut(s) 409
NdeII GATC 5 cut(s) 23, 58, 79, 301, 412
NlaIII CATG 5 cut(s) 148, 181, 232, 296, 382
PctI GAATGC 1 cut(s) 214
Psp6I CCWGG 1 cut(s) 212
PspGI CCWGG 1 cut(s) 212
SaqAI TTAA 2 cut(s) 318, 398
Sau3AI GATC 5 cut(s) 23, 58, 79, 301, 412
ScrFI CCNGG 2 cut(s) 21, 214
SetI ASST 5 cut(s) 69, 102, 143, 317, 398
SfaNI GCATC 2 cut(s) 75, 102
SfcI CTRYAG 1 cut(s) 198
Sse9I AATT 1 cut(s) 373
SspMI CTAG 2 cut(s) 135, 162
StyD4I CCNGG 2 cut(s) 19, 212
TaaI ACNGT 1 cut(s) 386
TaqI TCGA 1 cut(s) 38
TaqII GACCGA 1 cut(s) 181
TasI AATT 1 cut(s) 373
Tru1I TTAA 2 cut(s) 318, 398
Tru9I TTAA 2 cut(s) 318, 398
TspDTI ATGAA 6 cut(s) 17, 133, 143, 166, 217, 367
XspI CTAG 2 cut(s) 135, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.