pycom15g21260

Protein preY, mitochondrial

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
15271797 .. 15272732
936 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g21260.1

Sequence Viewer

Length: 285 bp
ATGGCGAGAGGAAGCATAAAGCTTCTTAAGGATGTTGGGTCTGGACTCAGCAAAACCCTAGCTGACATACTCGTCTGCCCACTTTCTAAGCAACCTCTAAGGTTTTGCGAGCAAACAAATTCCCTAATTAGTGATGCAATTGGTGTCTCCTTTCCTATAAAGGATGGGATACCTAGCTTAGTACCAACAGATGGCAAGGCACTCGAGGCGGATGAGACAATAAAAACTGAAGATTCTGCAGAATCATCAGACAAGCACGAAGCAGATCGAATAGGCAGTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

9.97

Weight (kDa)

5.01

Isoelectric Point (pI)

25.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Trm112p PF03966 18 - 56 4e-11 Trm112p-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 71
AccB7I CCANNNNNTGG 1 cut(s) 191
AciI CCGC 1 cut(s) 209
AcsI RAATTY 1 cut(s) 118
AcuI CTGAAG 1 cut(s) 249
AfaI GTAC 1 cut(s) 183
AfiI CCNNNNNNNGG 1 cut(s) 191
AflII CTTAAG 1 cut(s) 26
AluBI AGCT 3 cut(s) 22, 62, 177
AluI AGCT 3 cut(s) 22, 62, 177
Alw26I GTCTC 2 cut(s) 151, 209
Ama87I CYCGRG 1 cut(s) 203
ApoI RAATTY 1 cut(s) 118
ArsI GACNNNNNNTTYG 1 cut(s) 262
AvaI CYCGRG 1 cut(s) 203
BccI CCATC 2 cut(s) 158, 185
BcgI CGANNNNNNTGC 2 cut(s) 184, 218
BciVI GTATCC 1 cut(s) 162
BcoDI GTCTC 2 cut(s) 151, 209
BfaI CTAG 3 cut(s) 59, 174, 283
BfmI CTRYAG 1 cut(s) 237
BfrI CTTAAG 1 cut(s) 26
BfuI GTATCC 1 cut(s) 162
BmeT110I CYCGRG 1 cut(s) 203
BmsI GCATC 1 cut(s) 124
Bsc4I CCNNNNNNNGG 1 cut(s) 191
BseGI GGATG 3 cut(s) 37, 169, 217
BseLI CCNNNNNNNGG 1 cut(s) 191
BseMII CTCAG 1 cut(s) 61
BsiHKCI CYCGRG 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 191
BsmAI GTCTC 2 cut(s) 151, 209
BsoBI CYCGRG 1 cut(s) 203
Bsp143I GATC 1 cut(s) 265
BspACI CCGC 1 cut(s) 209
BspCNI CTCAG 1 cut(s) 60
BspMAI CTGCAG 1 cut(s) 241
BspTI CTTAAG 1 cut(s) 26
BssMI GATC 1 cut(s) 265
BstAFI CTTAAG 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 110
BstDEI CTNAG 4 cut(s) 47, 87, 98, 178
BstF5I GGATG 3 cut(s) 37, 169, 217
BstKTI GATC 1 cut(s) 268
BstMAI GTCTC 2 cut(s) 151, 209
BstMBI GATC 1 cut(s) 265
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstSFI CTRYAG 1 cut(s) 237
BsuI GTATCC 1 cut(s) 162
BtsCI GGATG 3 cut(s) 37, 169, 217
Cac8I GCNNGC 1 cut(s) 110
Csp6I GTAC 1 cut(s) 182
CviJI RGCY 3 cut(s) 22, 62, 177
CviKI_1 RGCY 3 cut(s) 22, 62, 177
CviQI GTAC 1 cut(s) 182
DdeI CTNAG 4 cut(s) 47, 87, 98, 178
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
DrdI GACNNNNNNGTC 1 cut(s) 71
DseDI GACNNNNNNGTC 1 cut(s) 71
EciI GGCGGA 1 cut(s) 224
Eco57I CTGAAG 1 cut(s) 249
Eco88I CYCGRG 1 cut(s) 203
FaiI YATR 3 cut(s) 17, 68, 158
FokI GGATG 3 cut(s) 44, 176, 224
FspBI CTAG 3 cut(s) 59, 174, 283
HindIII AAGCTT 1 cut(s) 20
HinfI GANTC 3 cut(s) 45, 233, 242
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 1 cut(s) 42
HpyCH4V TGCA 2 cut(s) 137, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
HpyF3I CTNAG 4 cut(s) 47, 87, 98, 178
Kzo9I GATC 1 cut(s) 265
LpnPI CCDG 1 cut(s) 27
LweI GCATC 1 cut(s) 124
MaeI CTAG 3 cut(s) 59, 174, 283
MaeIII GTNAC 1 cut(s) 278
MalI GATC 1 cut(s) 267
MboI GATC 1 cut(s) 265
MboII GAAGA 1 cut(s) 242
MfeI CAATTG 1 cut(s) 138
MluCI AATT 3 cut(s) 118, 126, 138
MlyI GAGTC 1 cut(s) 39
MnlI CCTC 2 cut(s) 105, 199
MseI TTAA 1 cut(s) 27
MspCI CTTAAG 1 cut(s) 26
MunI CAATTG 1 cut(s) 138
MwoI GCNNNNNNNGC 1 cut(s) 206
NdeII GATC 1 cut(s) 265
NmuCI GTSAC 1 cut(s) 278
PaeR7I CTCGAG 1 cut(s) 203
PfeI GAWTC 2 cut(s) 233, 242
PflMI CCANNNNNTGG 1 cut(s) 191
PleI GAGTC 1 cut(s) 39
PpsI GAGTC 1 cut(s) 39
PspXI VCTCGAGB 1 cut(s) 203
PstI CTGCAG 1 cut(s) 241
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 265
SchI GAGTC 1 cut(s) 39
SetI ASST 6 cut(s) 24, 64, 97, 104, 175, 179
SfaNI GCATC 1 cut(s) 124
SfcI CTRYAG 1 cut(s) 237
Sfr274I CTCGAG 1 cut(s) 203
SlaI CTCGAG 1 cut(s) 203
SmlI CTYRAG 2 cut(s) 26, 203
SmoI CTYRAG 2 cut(s) 26, 203
Sse9I AATT 3 cut(s) 118, 126, 138
SsiI CCGC 1 cut(s) 209
SspMI CTAG 3 cut(s) 59, 174, 283
TaqI TCGA 2 cut(s) 204, 268
TasI AATT 3 cut(s) 118, 126, 138
TfiI GAWTC 2 cut(s) 233, 242
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TseFI GTSAC 1 cut(s) 278
Tsp45I GTSAC 1 cut(s) 278
Van91I CCANNNNNTGG 1 cut(s) 191
Vha464I CTTAAG 1 cut(s) 26
XapI RAATTY 1 cut(s) 118
XhoI CTCGAG 1 cut(s) 203
XspI CTAG 3 cut(s) 59, 174, 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.