pycom15g21690

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
15720689 .. 15721131
443 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g21690.1

Sequence Viewer

Length: 393 bp
ATGGAAATTGTCAAAAACAGAAAAGTAGACTTGTCACACCTTAAGGTCTTTGGATGCATTTGTTTTGTCCATGTTCAGTCCTTGCATCGAGACAAACTTGACCCTAGGGCAACCAAATGCATTTTCCTTGGTTACTCATCCACACAAAAAGGATACAAATGTTACAATCCACAATTTAAGAGATTAATTGTTTCCAAGGATGTTAGATTTCATGAAACTAACCCTTATTACAGCAAATCTCTGGATAGTACAAGTGAAGGGGAATATTGCTTGGATCTGTTTCCATTGCCAAGAACTGAGACCCTTGCCACTGAAGTCACTCAACCTAATGCAATGGTGCCTGTACATCACACAAAGTTCCCCGCTGAAATTGACAACCCATATTGCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

15.0

Weight (kDa)

8.51

Isoelectric Point (pI)

24.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SH3_retrovirus PF25597 19 - 80 8.7e-28 Retroviral polymerase SH3-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 337
AccI GTMKAC 1 cut(s) 27
AciI CCGC 1 cut(s) 363
AclWI GGATC 1 cut(s) 282
AcuI CTGAAG 1 cut(s) 333
AfaI GTAC 2 cut(s) 250, 345
AflII CTTAAG 1 cut(s) 41
AjuI GAANNNNNNNTTGG 2 cut(s) 107, 139
Alw26I GTCTC 2 cut(s) 84, 293
AlwI GGATC 1 cut(s) 282
AseI ATTAAT 1 cut(s) 185
AspA2I CCTAGG 1 cut(s) 104
AvrII CCTAGG 1 cut(s) 104
BaeI ACNNNNGTAYC 2 cut(s) 145, 178
BanI GGYRCC 1 cut(s) 337
BciVI GTATCC 1 cut(s) 146
BcoDI GTCTC 2 cut(s) 84, 293
BfaI CTAG 1 cut(s) 105
BfrI CTTAAG 1 cut(s) 41
BfuI GTATCC 1 cut(s) 146
BlnI CCTAGG 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 339
BmsI GCATC 2 cut(s) 44, 94
BsaI GGTCTC 1 cut(s) 293
BsaJI CCNNGG 3 cut(s) 104, 127, 195
Bse3DI GCAATG 2 cut(s) 284, 339
BseDI CCNNGG 3 cut(s) 104, 127, 195
BseGI GGATG 3 cut(s) 59, 137, 205
BseMI GCAATG 2 cut(s) 284, 339
BseMII CTCAG 1 cut(s) 288
BshNI GGYRCC 1 cut(s) 337
BsmAI GTCTC 2 cut(s) 84, 293
Bso31I GGTCTC 1 cut(s) 293
Bsp1407I TGTACA 1 cut(s) 343
Bsp143I GATC 1 cut(s) 274
BspACI CCGC 1 cut(s) 363
BspCNI CTCAG 1 cut(s) 289
BspHI TCATGA 1 cut(s) 211
BspLI GGNNCC 1 cut(s) 339
BspPI GGATC 1 cut(s) 282
BspT107I GGYRCC 1 cut(s) 337
BspTI CTTAAG 1 cut(s) 41
BspTNI GGTCTC 1 cut(s) 293
BsrDI GCAATG 2 cut(s) 284, 339
BsrGI TGTACA 1 cut(s) 343
BssECI CCNNGG 3 cut(s) 104, 127, 195
BssMI GATC 1 cut(s) 274
BssT1I CCWWGG 3 cut(s) 104, 127, 195
BstAFI CTTAAG 1 cut(s) 41
BstAUI TGTACA 1 cut(s) 343
BstDEI CTNAG 1 cut(s) 297
BstF5I GGATG 3 cut(s) 59, 137, 205
BstKTI GATC 1 cut(s) 277
BstMAI GTCTC 2 cut(s) 84, 293
BstMBI GATC 1 cut(s) 274
BstX2I RGATCY 1 cut(s) 274
BstYI RGATCY 1 cut(s) 274
BsuI GTATCC 1 cut(s) 146
BtsCI GGATG 3 cut(s) 59, 137, 205
BtsIMutI CAGTG 1 cut(s) 309
CciI TCATGA 1 cut(s) 211
Csp6I GTAC 2 cut(s) 249, 344
CviAII CATG 2 cut(s) 71, 212
CviQI GTAC 2 cut(s) 249, 344
DdeI CTNAG 1 cut(s) 297
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
Eco130I CCWWGG 3 cut(s) 104, 127, 195
Eco31I GGTCTC 1 cut(s) 293
Eco57I CTGAAG 1 cut(s) 333
EcoT14I CCWWGG 3 cut(s) 104, 127, 195
EcoT22I ATGCAT 2 cut(s) 59, 122
ErhI CCWWGG 3 cut(s) 104, 127, 195
FaeI CATG 2 cut(s) 74, 215
FaiI YATR 3 cut(s) 72, 213, 382
FatI CATG 2 cut(s) 70, 211
FauI CCCGC 1 cut(s) 370
FblI GTMKAC 1 cut(s) 27
FokI GGATG 3 cut(s) 66, 124, 212
FspBI CTAG 1 cut(s) 105
Hin1II CATG 2 cut(s) 74, 215
Hpy166II GTNNAC 1 cut(s) 28
Hpy188III TCNNGA 4 cut(s) 89, 212, 242, 390
Hpy8I GTNNAC 1 cut(s) 28
HpyAV CCTTC 1 cut(s) 251
HpyCH4V TGCA 4 cut(s) 57, 85, 120, 332
HpyF3I CTNAG 1 cut(s) 297
Hsp92II CATG 2 cut(s) 74, 215
Kzo9I GATC 1 cut(s) 274
LpnPI CCDG 2 cut(s) 227, 354
LweI GCATC 2 cut(s) 44, 94
MaeI CTAG 1 cut(s) 105
MaeIII GTNAC 4 cut(s) 33, 131, 161, 316
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MflI RGATCY 1 cut(s) 274
MluCI AATT 4 cut(s) 6, 173, 186, 369
Mph1103I ATGCAT 2 cut(s) 59, 122
MseI TTAA 3 cut(s) 42, 177, 185
MspA1I CMGCKG 1 cut(s) 365
MspCI CTTAAG 1 cut(s) 41
NdeII GATC 1 cut(s) 274
NlaIII CATG 2 cut(s) 74, 215
NlaIV GGNNCC 1 cut(s) 339
NmuCI GTSAC 2 cut(s) 33, 316
NsiI ATGCAT 2 cut(s) 59, 122
PagI TCATGA 1 cut(s) 211
PshBI ATTAAT 1 cut(s) 185
PspN4I GGNNCC 1 cut(s) 339
PsuI RGATCY 1 cut(s) 274
RsaI GTAC 2 cut(s) 250, 345
RsaNI GTAC 2 cut(s) 249, 344
SaqAI TTAA 3 cut(s) 42, 177, 185
Sau3AI GATC 1 cut(s) 274
SetI ASST 3 cut(s) 42, 48, 328
SfaNI GCATC 2 cut(s) 44, 94
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 4 cut(s) 6, 173, 186, 369
SsiI CCGC 1 cut(s) 363
SspI AATATT 1 cut(s) 266
SspMI CTAG 1 cut(s) 105
StyI CCWWGG 3 cut(s) 104, 127, 195
TaqI TCGA 1 cut(s) 88
TasI AATT 4 cut(s) 6, 173, 186, 369
TatI WGTACW 2 cut(s) 248, 343
Tru1I TTAA 3 cut(s) 42, 177, 185
Tru9I TTAA 3 cut(s) 42, 177, 185
TscAI CASTG 1 cut(s) 316
TseFI GTSAC 2 cut(s) 33, 316
Tsp45I GTSAC 2 cut(s) 33, 316
TspDTI ATGAA 2 cut(s) 200, 228
TspRI CASTG 1 cut(s) 316
Vha464I CTTAAG 1 cut(s) 41
VspI ATTAAT 1 cut(s) 185
XmaJI CCTAGG 1 cut(s) 104
XmiI GTMKAC 1 cut(s) 27
XspI CTAG 1 cut(s) 105
Zsp2I ATGCAT 2 cut(s) 59, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.