Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004135.1

Orthogroup ID

OG0006436

Physical Location & Seq

Genomic Coordinates Reverse (-)

41815 .. 42192

Gene Structure 378 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004135.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

atgtgtagttttctcaaaggaagcaagctatggcgttatgctactagagatattactcaaccaaccaagctcaataacgaaactgatgacaagtttgctgaacgacttgaagattgggacaataagaaccaccaggtcatcacttggtttcgcaacaccttatcttcctcaatcaaccatcaatttggcctgttcaacacagccaaggacatttggaattttttaaagaagcgctatacaaccacagatcttgctcacagatatcaacttttgagcacccttcatcgtatgcgccaagaacctggtcagtcaatcaattcattcctctctcaaatgcaatttatttgggatcaattaacacttgcaaaacctacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4219 Retrotran_gag_2 gag_pre-integrs rve

Protein Analysis

125

Amino Acids

14.96

Weight (kDa)

9.56

Isoelectric Point (pI)

20.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006436)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21280
fragaria_vesca	FvH4_3g37931 FvH4_3g37931 FvH4_3g37931
malus_domestica	MD01G1094300.v1.1 MD02G1156200.v1.1 MD10G1309400.v1.1 MD14G1005300.v1.1
pyrus_communis	pycom02g16670 pycom03g10030 pycom04g21390 pycom05g29420 pycom07g08570 pycom08g06430 pycom15g03080 pycom15g21690
rosa_chinensis	RchiOBHm_Chr4g0394011 RchiOBHm_Chr4g0436631
rosa_multiflora	Rmu_sc0002646.1_g000018 Rmu_sc0004135.1_g000007
rosa_roxburghii	Rroxscaffold_2G00099130
rosa_samantha	Rh1AG086000 Rh2BG003200 Rh5DG450100 Rh7AG095400
rosa_wichuraiana	Rw1G012660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	357
AcsI	RAATTY	1 cut(s)	217
AfeI	AGCGCT	1 cut(s)	233
AgsI	TTSAA	2 cut(s)	110, 196
AjnI	CCWGG	2 cut(s)	132, 301
AluBI	AGCT	2 cut(s)	28, 70
AluI	AGCT	2 cut(s)	28, 70
Alw21I	GWGCWC	1 cut(s)	278
AlwI	GGATC	1 cut(s)	357
Aor51HI	AGCGCT	1 cut(s)	233
AoxI	GGCC	1 cut(s)	187
ApoI	RAATTY	1 cut(s)	217
AspLEI	GCGC	2 cut(s)	234, 294
Bbv12I	GWGCWC	1 cut(s)	278
BccI	CCATC	1 cut(s)	186
BciT130I	CCWGG	2 cut(s)	134, 303
BfaI	CTAG	1 cut(s)	45
BfoI	RGCGCY	1 cut(s)	235
BglII	AGATCT	1 cut(s)	247
Bme1390I	CCNGG	2 cut(s)	134, 303
BmrFI	CCNGG	2 cut(s)	134, 303
BsaJI	CCNNGG	1 cut(s)	204
BseBI	CCWGG	2 cut(s)	134, 303
BseDI	CCNNGG	1 cut(s)	204
BshFI	GGCC	1 cut(s)	189
BsiHKAI	GWGCWC	1 cut(s)	278
BslFI	GGGAC	1 cut(s)	131
BsmFI	GGGAC	1 cut(s)	131
BsnI	GGCC	1 cut(s)	189
Bsp1286I	GDGCHC	1 cut(s)	278
Bsp143I	GATC	2 cut(s)	247, 349
BspANI	GGCC	1 cut(s)	189
BspPI	GGATC	1 cut(s)	357
BssECI	CCNNGG	1 cut(s)	204
BssMI	GATC	2 cut(s)	247, 349
BssT1I	CCWWGG	1 cut(s)	204
Bst2UI	CCWGG	2 cut(s)	134, 303
BstC8I	GCNNGC	1 cut(s)	26
BstH2I	RGCGCY	1 cut(s)	235
BstHHI	GCGC	2 cut(s)	234, 294
BstKTI	GATC	2 cut(s)	250, 352
BstMBI	GATC	2 cut(s)	247, 349
BstNI	CCWGG	2 cut(s)	134, 303
BstSCI	CCNGG	2 cut(s)	132, 301
BstX2I	RGATCY	1 cut(s)	247
BstXI	CCANNNNNNTGG	2 cut(s)	185, 302
BstYI	RGATCY	1 cut(s)	247
BsuRI	GGCC	1 cut(s)	189
Cac8I	GCNNGC	1 cut(s)	26
CfoI	GCGC	2 cut(s)	234, 294
CsiI	ACCWGGT	2 cut(s)	132, 301
CspCI	CAANNNNNGTGG	2 cut(s)	232, 267
CviAII	CATG	1 cut(s)	375
CviJI	RGCY	4 cut(s)	28, 70, 189, 203
CviKI_1	RGCY	4 cut(s)	28, 70, 189, 203
DpnI	GATC	2 cut(s)	249, 351
DpnII	GATC	2 cut(s)	247, 349
DraI	TTTAAA	1 cut(s)	225
Eco130I	CCWWGG	1 cut(s)	204
Eco32I	GATATC	1 cut(s)	263
Eco47III	AGCGCT	1 cut(s)	233
EcoRII	CCWGG	2 cut(s)	132, 301
EcoRV	GATATC	1 cut(s)	263
EcoT14I	CCWWGG	1 cut(s)	204
ErhI	CCWWGG	1 cut(s)	204
FaeI	CATG	1 cut(s)	378
FaiI	YATR	5 cut(s)	31, 39, 237, 290, 376
FaqI	GGGAC	1 cut(s)	131
FatI	CATG	1 cut(s)	374
FspBI	CTAG	1 cut(s)	45
GlaI	GCGC	2 cut(s)	233, 293
HaeII	RGCGCY	1 cut(s)	235
HaeIII	GGCC	1 cut(s)	189
HhaI	GCGC	2 cut(s)	234, 294
Hin1II	CATG	1 cut(s)	378
Hin6I	GCGC	2 cut(s)	232, 292
HinP1I	GCGC	2 cut(s)	232, 292
HpyAV	CCTTC	1 cut(s)	290
HpyCH4V	TGCA	2 cut(s)	337, 365
Hsp92II	CATG	1 cut(s)	378
HspAI	GCGC	2 cut(s)	232, 292
Kzo9I	GATC	2 cut(s)	247, 349
LpnPI	CCDG	5 cut(s)	119, 146, 203, 288, 315
MabI	ACCWGGT	2 cut(s)	132, 301
MaeI	CTAG	1 cut(s)	45
MalI	GATC	2 cut(s)	249, 351
MboI	GATC	2 cut(s)	247, 349
MboII	GAAGA	2 cut(s)	122, 156
MflI	RGATCY	1 cut(s)	247
MhlI	GDGCHC	1 cut(s)	278
MluCI	AATT	5 cut(s)	182, 217, 316, 338, 353
MnlI	CCTC	2 cut(s)	178, 335
MseI	TTAA	2 cut(s)	224, 356
MspR9I	CCNGG	2 cut(s)	134, 303
MvaI	CCWGG	2 cut(s)	134, 303
NdeII	GATC	2 cut(s)	247, 349
NlaIII	CATG	1 cut(s)	378
Psp6I	CCWGG	2 cut(s)	132, 301
PspGI	CCWGG	2 cut(s)	132, 301
PsuI	RGATCY	1 cut(s)	247
SaqAI	TTAA	2 cut(s)	224, 356
Sau3AI	GATC	2 cut(s)	247, 349
ScrFI	CCNGG	2 cut(s)	134, 303
SduI	GDGCHC	1 cut(s)	278
SetI	ASST	6 cut(s)	30, 72, 138, 161, 304, 373
SexAI	ACCWGGT	2 cut(s)	132, 301
Sse9I	AATT	5 cut(s)	182, 217, 316, 338, 353
SspMI	CTAG	1 cut(s)	45
StyD4I	CCNGG	2 cut(s)	132, 301
StyI	CCWWGG	1 cut(s)	204
TasI	AATT	5 cut(s)	182, 217, 316, 338, 353
Tru1I	TTAA	2 cut(s)	224, 356
Tru9I	TTAA	2 cut(s)	224, 356
TspDTI	ATGAA	2 cut(s)	272, 309
XapI	RAATTY	1 cut(s)	217
XspI	CTAG	1 cut(s)	45

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.