pycom16g14990

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
10976698 .. 10977826
1129 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g14990.3

Sequence Viewer

Length: 339 bp
ATGTTAGCATCCCAAACTAGCACACCTCGGCTCACTCCCCCTGGTTCTCCTCCTATCTATTCTGCATCCGCATCACCAACAAGAACATCGAAACCTGTGTCTCCAAAGCGACACTCCATGTCCTTTGCCACTTCAAGAGGCATGTTTGATAACAGATCGTCTGCGCCCTCAAGCCATCACAGCTCGGAACGCGCAAGAACTAGGGTGGATGGGAAAGAGTTTTTCTGTCAAGTCAGGAGTTGTCTGTCTTGCGAGCAGTTTGGTGCATTACTGGCAAATGTTAAGGTACTAAACGGGAAACAAGCAAACAAAAGAGGAGACGCTACAGAAGGCGGATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

11.99

Weight (kDa)

10.37

Isoelectric Point (pI)

66.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014233)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 192
AciI CCGC 2 cut(s) 69, 333
AfaI GTAC 1 cut(s) 288
AgsI TTSAA 1 cut(s) 135
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 1 cut(s) 183
AluI AGCT 1 cut(s) 183
Alw26I GTCTC 2 cut(s) 105, 312
ArsI GACNNNNNNTTYG 2 cut(s) 83, 115
AspLEI GCGC 2 cut(s) 166, 194
AsuHPI GGTGA 1 cut(s) 66
BccI CCATC 2 cut(s) 183, 203
BciT130I CCWGG 1 cut(s) 42
BcoDI GTCTC 2 cut(s) 105, 312
BfaI CTAG 2 cut(s) 18, 201
BfmI CTRYAG 1 cut(s) 324
Bme1390I CCNGG 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 42
BmsI GCATC 3 cut(s) 17, 74, 80
BpuEI CTTGAG 1 cut(s) 154
BsaJI CCNNGG 2 cut(s) 26, 40
Bse1I ACTGG 1 cut(s) 276
BseBI CCWGG 1 cut(s) 42
BseDI CCNNGG 2 cut(s) 26, 40
BseGI GGATG 3 cut(s) 8, 65, 214
BseNI ACTGG 1 cut(s) 276
BseRI GAGGAG 2 cut(s) 39, 330
Bsh1236I CGCG 1 cut(s) 192
BsmAI GTCTC 2 cut(s) 105, 312
BsmBI CGTCTC 1 cut(s) 312
Bsp143I GATC 1 cut(s) 155
BspACI CCGC 2 cut(s) 69, 333
BspFNI CGCG 1 cut(s) 192
BsrI ACTGG 1 cut(s) 276
BssECI CCNNGG 2 cut(s) 26, 40
BssMI GATC 1 cut(s) 155
Bst2UI CCWGG 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 254
BstF5I GGATG 3 cut(s) 8, 65, 214
BstFNI CGCG 1 cut(s) 192
BstHHI GCGC 2 cut(s) 166, 194
BstKTI GATC 1 cut(s) 158
BstMAI GTCTC 2 cut(s) 105, 312
BstMBI GATC 1 cut(s) 155
BstMWI GCNNNNNNNGC 3 cut(s) 180, 189, 272
BstNI CCWGG 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 324
BstUI CGCG 1 cut(s) 192
BtsCI GGATG 3 cut(s) 8, 65, 214
Cac8I GCNNGC 1 cut(s) 254
CfoI GCGC 2 cut(s) 166, 194
CseI GACGC 1 cut(s) 329
Csp6I GTAC 1 cut(s) 287
CviAII CATG 2 cut(s) 118, 142
CviJI RGCY 3 cut(s) 31, 174, 183
CviKI_1 RGCY 3 cut(s) 31, 174, 183
CviQI GTAC 1 cut(s) 287
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 40
Esp3I CGTCTC 1 cut(s) 312
FaeI CATG 2 cut(s) 121, 145
FaiI YATR 2 cut(s) 119, 143
FatI CATG 2 cut(s) 117, 141
FokI GGATG 2 cut(s) 52, 221
FspBI CTAG 2 cut(s) 18, 201
GlaI GCGC 2 cut(s) 165, 193
HgaI GACGC 1 cut(s) 329
HhaI GCGC 2 cut(s) 166, 194
Hin1II CATG 2 cut(s) 121, 145
Hin6I GCGC 2 cut(s) 164, 192
HinP1I GCGC 2 cut(s) 164, 192
HphI GGTGA 1 cut(s) 66
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 2 cut(s) 135, 235
HpyAV CCTTC 1 cut(s) 323
HpyCH4V TGCA 2 cut(s) 65, 266
HpyF10VI GCNNNNNNNGC 3 cut(s) 180, 189, 272
Hsp92II CATG 2 cut(s) 121, 145
HspAI GCGC 2 cut(s) 164, 192
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 5 cut(s) 27, 54, 108, 220, 257
LweI GCATC 3 cut(s) 17, 74, 80
MaeI CTAG 2 cut(s) 18, 201
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MnlI CCTC 5 cut(s) 36, 60, 131, 178, 308
MseI TTAA 1 cut(s) 282
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
MvnI CGCG 1 cut(s) 192
MwoI GCNNNNNNNGC 3 cut(s) 180, 189, 272
NdeII GATC 1 cut(s) 155
NlaIII CATG 2 cut(s) 121, 145
NmeAIII GCCGAG 1 cut(s) 7
NspI RCATGY 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
RsaI GTAC 1 cut(s) 288
RsaNI GTAC 1 cut(s) 287
SaqAI TTAA 1 cut(s) 282
Sau3AI GATC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 42
SetI ASST 4 cut(s) 28, 97, 185, 288
SfaNI GCATC 3 cut(s) 17, 74, 80
SfcI CTRYAG 1 cut(s) 324
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
SsiI CCGC 2 cut(s) 69, 333
SspMI CTAG 2 cut(s) 18, 201
StyD4I CCNGG 1 cut(s) 40
TaqI TCGA 1 cut(s) 89
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
XceI RCATGY 1 cut(s) 145
XspI CTAG 2 cut(s) 18, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.