pycom16g24550

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
26128357 .. 26130649
2293 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 465 bp
ATGGGGTTGTTTAAGAGGATTGTGGGGTTACTAGGGTTTGCCAAGGACGACGGACACGAAGGCAAAGACAACGATGAGGAAGAAGACAACGATAACCACGCCCAGAACCGGGACCACTTCCAAGAAACTGGGCTTCCCCTCAAAGGCTTTAGCGTTCCAGTCCAGGTCGCCGTTGACCGTAATCTGCCCGGCCCCGTCCTCGTTCCTTGTCGTTCCGGCGACGGCGGTGTCCAGGGTCTAAGATGGCATGCAAAGCGACTCAGAATAGACGAAGATGGAGATGTAGCAGATGAGTTCCTTGACGAGGTCTTCCCAGGGATGTCAATCAGTACAGAAAATAATAGGGCGTTACCAAGGTTTGAAGTGAAACACAATACGAAGCCAGCTAAAGTGAAGACTCAGGCCTTGCATGATGGGAATATCCGACAGTGCGTGGAATACCAGGGTAGATCGCAGTGGAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

17.3

Weight (kDa)

5.66

Isoelectric Point (pI)

47.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013049)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 227
AciI CCGC 1 cut(s) 225
AfaI GTAC 1 cut(s) 331
AfiI CCNNNNNNNGG 4 cut(s) 108, 109, 143, 304
AgsI TTSAA 1 cut(s) 362
AjnI CCWGG 4 cut(s) 162, 231, 313, 441
AluBI AGCT 1 cut(s) 386
AluI AGCT 1 cut(s) 386
AoxI GGCC 2 cut(s) 190, 402
AspS9I GGNCC 2 cut(s) 112, 191
AsuC2I CCSGG 2 cut(s) 110, 189
AvaII GGWCC 1 cut(s) 112
BbsI GAAGAC 3 cut(s) 90, 301, 401
BccI CCATC 3 cut(s) 237, 269, 407
BceAI ACGGC 2 cut(s) 155, 238
BciT130I CCWGG 4 cut(s) 164, 233, 315, 443
BcnI CCSGG 2 cut(s) 110, 189
BfaI CTAG 1 cut(s) 32
Bme1390I CCNGG 6 cut(s) 110, 164, 189, 233, 315, 443
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 2 cut(s) 112, 191
BmiI GGNNCC 2 cut(s) 113, 193
BmrFI CCNGG 6 cut(s) 110, 164, 189, 233, 315, 443
BmrI ACTGGG 1 cut(s) 138
BmuI ACTGGG 1 cut(s) 138
BpiI GAAGAC 3 cut(s) 90, 301, 401
BpuMI CCSGG 2 cut(s) 110, 189
BsaBI GATNNNNATC 1 cut(s) 323
BsaJI CCNNGG 6 cut(s) 42, 232, 313, 314, 353, 442
Bsc4I CCNNNNNNNGG 4 cut(s) 108, 109, 143, 304
Bse1I ACTGG 2 cut(s) 133, 158
Bse8I GATNNNNATC 1 cut(s) 323
BseBI CCWGG 4 cut(s) 164, 233, 315, 443
BseDI CCNNGG 6 cut(s) 42, 232, 313, 314, 353, 442
BseGI GGATG 1 cut(s) 324
BseJI GATNNNNATC 1 cut(s) 323
BseLI CCNNNNNNNGG 4 cut(s) 108, 109, 143, 304
BseMII CTCAG 2 cut(s) 274, 413
BseNI ACTGG 2 cut(s) 133, 158
BshFI GGCC 2 cut(s) 192, 404
BsiSI CCGG 3 cut(s) 109, 189, 216
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 4 cut(s) 108, 109, 143, 304
BsmFI GGGAC 1 cut(s) 125
BsnI GGCC 2 cut(s) 192, 404
Bsp143I GATC 1 cut(s) 449
BspACI CCGC 1 cut(s) 225
BspANI GGCC 2 cut(s) 192, 404
BspCNI CTCAG 2 cut(s) 273, 412
BspLI GGNNCC 2 cut(s) 113, 193
BsrI ACTGG 2 cut(s) 133, 158
BssECI CCNNGG 6 cut(s) 42, 232, 313, 314, 353, 442
BssMI GATC 1 cut(s) 449
BssT1I CCWWGG 2 cut(s) 42, 353
Bst2UI CCWGG 4 cut(s) 164, 233, 315, 443
Bst4CI ACNGT 2 cut(s) 179, 429
BstC8I GCNNGC 2 cut(s) 249, 384
BstDEI CTNAG 3 cut(s) 239, 260, 399
BstENI CCTNNNNNAGG 1 cut(s) 302
BstF5I GGATG 1 cut(s) 324
BstKTI GATC 1 cut(s) 452
BstMBI GATC 1 cut(s) 449
BstMWI GCNNNNNNNGC 1 cut(s) 253
BstNI CCWGG 4 cut(s) 164, 233, 315, 443
BstNSI RCATGY 1 cut(s) 251
BstSCI CCNGG 6 cut(s) 108, 162, 187, 231, 313, 441
BstV2I GAAGAC 3 cut(s) 90, 301, 401
BstXI CCANNNNNNTGG 1 cut(s) 128
BsuRI GGCC 2 cut(s) 192, 404
BtsCI GGATG 1 cut(s) 324
BtsI GCAGTG 1 cut(s) 461
BtsIMutI CAGTG 2 cut(s) 434, 461
Cac8I GCNNGC 2 cut(s) 249, 384
Cfr13I GGNCC 2 cut(s) 112, 191
Csp6I GTAC 1 cut(s) 330
CviAII CATG 2 cut(s) 248, 410
CviJI RGCY 6 cut(s) 133, 147, 192, 382, 386, 404
CviKI_1 RGCY 6 cut(s) 133, 147, 192, 382, 386, 404
CviQI GTAC 1 cut(s) 330
DdeI CTNAG 3 cut(s) 239, 260, 399
DpnI GATC 1 cut(s) 451
DpnII GATC 1 cut(s) 449
DrdI GACNNNNNNGTC 1 cut(s) 227
DseDI GACNNNNNNGTC 1 cut(s) 227
Eco130I CCWWGG 2 cut(s) 42, 353
Eco147I AGGCCT 1 cut(s) 404
Eco47I GGWCC 1 cut(s) 112
EcoNI CCTNNNNNAGG 1 cut(s) 302
EcoRII CCWGG 4 cut(s) 162, 231, 313, 441
EcoT14I CCWWGG 2 cut(s) 42, 353
ErhI CCWWGG 2 cut(s) 42, 353
FaeI CATG 2 cut(s) 251, 413
FaiI YATR 2 cut(s) 249, 411
FaqI GGGAC 1 cut(s) 125
FatI CATG 2 cut(s) 247, 409
FokI GGATG 1 cut(s) 331
FspBI CTAG 1 cut(s) 32
HaeIII GGCC 2 cut(s) 192, 404
HapII CCGG 3 cut(s) 109, 189, 216
Hin1II CATG 2 cut(s) 251, 413
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HinfI GANTC 2 cut(s) 258, 397
HpaII CCGG 3 cut(s) 109, 189, 216
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 2 cut(s) 263, 425
Hpy8I GTNNAC 1 cut(s) 175
Hpy99I CGWCG 2 cut(s) 53, 224
HpyAV CCTTC 1 cut(s) 53
HpyCH4III ACNGT 2 cut(s) 179, 429
HpyCH4V TGCA 2 cut(s) 251, 409
HpyF10VI GCNNNNNNNGC 1 cut(s) 253
HpyF3I CTNAG 3 cut(s) 239, 260, 399
Hsp92II CATG 2 cut(s) 251, 413
Kzo9I GATC 1 cut(s) 449
MaeI CTAG 1 cut(s) 32
MaeIII GTNAC 2 cut(s) 27, 348
MalI GATC 1 cut(s) 451
MboI GATC 1 cut(s) 449
MboII GAAGA 5 cut(s) 92, 95, 284, 301, 406
MlyI GAGTC 2 cut(s) 252, 391
MmeI TCCRAC 1 cut(s) 448
MnlI CCTC 5 cut(s) 9, 70, 149, 209, 298
MseI TTAA 1 cut(s) 12
MspI CCGG 3 cut(s) 109, 189, 216
MspR9I CCNGG 6 cut(s) 110, 164, 189, 233, 315, 443
MvaI CCWGG 4 cut(s) 164, 233, 315, 443
MwoI GCNNNNNNNGC 1 cut(s) 253
NciI CCSGG 2 cut(s) 110, 189
NdeII GATC 1 cut(s) 449
NlaIII CATG 2 cut(s) 251, 413
NlaIV GGNNCC 2 cut(s) 113, 193
NspI RCATGY 1 cut(s) 251
PaeI GCATGC 1 cut(s) 251
PasI CCCWGGG 1 cut(s) 314
PceI AGGCCT 1 cut(s) 404
PcsI WCGNNNNNNNCGW 1 cut(s) 54
PflFI GACNNNGTC 1 cut(s) 305
PleI GAGTC 2 cut(s) 252, 391
PpsI GAGTC 2 cut(s) 252, 391
Psp6I CCWGG 4 cut(s) 162, 231, 313, 441
PspGI CCWGG 4 cut(s) 162, 231, 313, 441
PspN4I GGNNCC 2 cut(s) 113, 193
PspPI GGNCC 2 cut(s) 112, 191
PsyI GACNNNGTC 1 cut(s) 305
RsaI GTAC 1 cut(s) 331
RsaNI GTAC 1 cut(s) 330
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 449
Sau96I GGNCC 2 cut(s) 112, 191
SchI GAGTC 2 cut(s) 252, 391
ScrFI CCNGG 6 cut(s) 110, 164, 189, 233, 315, 443
SetI ASST 4 cut(s) 168, 309, 359, 388
SinI GGWCC 1 cut(s) 112
SphI GCATGC 1 cut(s) 251
SseBI AGGCCT 1 cut(s) 404
SsiI CCGC 1 cut(s) 225
SspMI CTAG 1 cut(s) 32
StuI AGGCCT 1 cut(s) 404
StyD4I CCNGG 6 cut(s) 108, 162, 187, 231, 313, 441
StyI CCWWGG 2 cut(s) 42, 353
TaaI ACNGT 2 cut(s) 179, 429
TatI WGTACW 1 cut(s) 329
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TscAI CASTG 2 cut(s) 434, 461
TspGWI ACGGA 1 cut(s) 66
TspRI CASTG 2 cut(s) 434, 461
Tth111I GACNNNGTC 1 cut(s) 305
VpaK11BI GGWCC 1 cut(s) 112
XagI CCTNNNNNAGG 1 cut(s) 302
XceI RCATGY 1 cut(s) 251
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.