Rroxscaffold_3G00249500

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
43272431 .. 43275169
2739 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00249500.1

Sequence Viewer

Length: 381 bp
ATGGGGCTGTTTAAGAAGCTATCGCTGTTTCTAGGGTTTTCCAAAGACGATGACCACGAAGTCAAAGACAAAGAGGAGGACGAGGACGATAGCCAGCCCCGTAATCAGGCTCATTTCCAAGACACCGGCCTTCCCCGTAGAGGCTTCAGCGTCCCTGTTCAAGTCGCCGTTGACCGTCCTCTCCCCGGCCCAATTCTCATTCCTTGTCGCTCCGGCGACGGCGGTGTTCAGGGTCTAAGATGGCATGCAAGGCGACAAAGGATGGATGAAGATGGAGATGTAGCAGATCAGTTCCTGGATGAGGTCTTCCCAGATATGTCTGCCAGCAGGGAAAACAGAAGGTTTGAAGTGAAAAATCCAGTACGAGGCCAGCTAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.38

Weight (kDa)

5.37

Isoelectric Point (pI)

53.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013049)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 59
AciI CCGC 1 cut(s) 222
AcuI CTGAAG 1 cut(s) 130
AfaI GTAC 1 cut(s) 363
AfiI CCNNNNNNNGG 5 cut(s) 106, 140, 185, 301, 365
AgsI TTSAA 2 cut(s) 161, 347
AjnI CCWGG 1 cut(s) 294
AluBI AGCT 2 cut(s) 19, 373
AluI AGCT 2 cut(s) 19, 373
AlwNI CAGNNNCTG 1 cut(s) 295
AoxI GGCC 3 cut(s) 127, 187, 367
AspS9I GGNCC 1 cut(s) 188
AsuC2I CCSGG 1 cut(s) 186
BbsI GAAGAC 1 cut(s) 298
BccI CCATC 3 cut(s) 234, 256, 266
BceAI ACGGC 2 cut(s) 152, 235
BciT130I CCWGG 1 cut(s) 296
BcnI CCSGG 1 cut(s) 186
BfaI CTAG 1 cut(s) 32
Bme1390I CCNGG 2 cut(s) 186, 296
BmgT120I GGNCC 1 cut(s) 188
BmrFI CCNGG 2 cut(s) 186, 296
BpiI GAAGAC 1 cut(s) 298
BpuMI CCSGG 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 184
Bsc4I CCNNNNNNNGG 5 cut(s) 106, 140, 185, 301, 365
Bse118I RCCGGY 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 359
BseBI CCWGG 1 cut(s) 296
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 3 cut(s) 267, 271, 304
BseLI CCNNNNNNNGG 5 cut(s) 106, 140, 185, 301, 365
BseNI ACTGG 1 cut(s) 359
BseRI GAGGAG 1 cut(s) 89
BshFI GGCC 3 cut(s) 129, 189, 369
BsiSI CCGG 3 cut(s) 126, 186, 213
BslFI GGGAC 1 cut(s) 137
BslI CCNNNNNNNGG 5 cut(s) 106, 140, 185, 301, 365
BsmFI GGGAC 1 cut(s) 137
BsnI GGCC 3 cut(s) 129, 189, 369
Bsp143I GATC 1 cut(s) 286
BspACI CCGC 1 cut(s) 222
BspANI GGCC 3 cut(s) 129, 189, 369
BsrFI RCCGGY 1 cut(s) 125
BsrI ACTGG 1 cut(s) 359
BssAI RCCGGY 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 1 cut(s) 286
Bst2UI CCWGG 1 cut(s) 296
Bst4CI ACNGT 1 cut(s) 176
BstC8I GCNNGC 4 cut(s) 95, 246, 325, 371
BstDEI CTNAG 1 cut(s) 236
BstENI CCTNNNNNAGG 1 cut(s) 299
BstF5I GGATG 3 cut(s) 267, 271, 304
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BstMWI GCNNNNNNNGC 1 cut(s) 250
BstNI CCWGG 1 cut(s) 296
BstNSI RCATGY 1 cut(s) 248
BstSCI CCNGG 2 cut(s) 184, 294
BstV2I GAAGAC 1 cut(s) 298
BsuRI GGCC 3 cut(s) 129, 189, 369
BtsCI GGATG 3 cut(s) 267, 271, 304
Cac8I GCNNGC 4 cut(s) 95, 246, 325, 371
CaiI CAGNNNCTG 1 cut(s) 295
Cfr10I RCCGGY 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 188
CseI GACGC 1 cut(s) 139
Csp6I GTAC 1 cut(s) 362
CviAII CATG 1 cut(s) 245
CviQI GTAC 1 cut(s) 362
DdeI CTNAG 1 cut(s) 236
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
DrdI GACNNNNNNGTC 1 cut(s) 59
DseDI GACNNNNNNGTC 1 cut(s) 59
Eco57I CTGAAG 1 cut(s) 130
EcoNI CCTNNNNNAGG 1 cut(s) 299
EcoRII CCWGG 1 cut(s) 294
FaeI CATG 1 cut(s) 248
FaiI YATR 2 cut(s) 246, 317
FaqI GGGAC 1 cut(s) 137
FatI CATG 1 cut(s) 244
FokI GGATG 3 cut(s) 274, 278, 311
FspBI CTAG 1 cut(s) 32
HaeIII GGCC 3 cut(s) 129, 189, 369
HapII CCGG 3 cut(s) 126, 186, 213
HgaI GACGC 1 cut(s) 139
Hin1II CATG 1 cut(s) 248
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HpaII CCGG 3 cut(s) 126, 186, 213
Hpy166II GTNNAC 1 cut(s) 172
Hpy8I GTNNAC 1 cut(s) 172
Hpy99I CGWCG 1 cut(s) 221
HpyAV CCTTC 2 cut(s) 140, 333
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 250
HpyF3I CTNAG 1 cut(s) 236
Hsp92II CATG 1 cut(s) 248
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 1 cut(s) 215
MaeI CTAG 1 cut(s) 32
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 2 cut(s) 281, 298
MluCI AATT 1 cut(s) 192
MnlI CCTC 7 cut(s) 67, 70, 76, 134, 189, 295, 359
MseI TTAA 1 cut(s) 12
MspI CCGG 3 cut(s) 126, 186, 213
MspR9I CCNGG 2 cut(s) 186, 296
MvaI CCWGG 1 cut(s) 296
MwoI GCNNNNNNNGC 1 cut(s) 250
NciI CCSGG 1 cut(s) 186
NdeII GATC 1 cut(s) 286
NlaIII CATG 1 cut(s) 248
NspI RCATGY 1 cut(s) 248
PaeI GCATGC 1 cut(s) 248
PcsI WCGNNNNNNNCGW 1 cut(s) 54
PfoI TCCNGGA 1 cut(s) 294
Psp6I CCWGG 1 cut(s) 294
PspGI CCWGG 1 cut(s) 294
PspPI GGNCC 1 cut(s) 188
PstNI CAGNNNCTG 1 cut(s) 295
RsaI GTAC 1 cut(s) 363
RsaNI GTAC 1 cut(s) 362
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 1 cut(s) 286
Sau96I GGNCC 1 cut(s) 188
ScrFI CCNGG 2 cut(s) 186, 296
SetI ASST 4 cut(s) 21, 306, 344, 375
SphI GCATGC 1 cut(s) 248
Sse9I AATT 1 cut(s) 192
SsiI CCGC 1 cut(s) 222
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 184, 294
TaaI ACNGT 1 cut(s) 176
TasI AATT 1 cut(s) 192
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 282
XagI CCTNNNNNAGG 1 cut(s) 299
XceI RCATGY 1 cut(s) 248
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.