pycom16g25890

Niemann-Pick C1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
28091743 .. 28096537
4795 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g25890.2

Sequence Viewer

Length: 279 bp
ATGGATGATGGCGAAGTTAATTCTAACAGGGAGAAGAATGAGAACCCTCTGATGCAGGTATTTGAAGATGTTCGTCACATTGGAGATGATGTCCAACTTTCAATTGTGCAAGGATACATGTCAAAAATTTTCAGGAGATATGGAACATGGGTTGCTAGGAATCCAATCATAGTGTTGATCTCATCATTGGCTGTAGTTCTTCTGCTTTGTTTGGGTCTTATGCGTTTAAAAAATGCAACAATGTATGATGTTGCCGCTGTGGGTTGGGCCTGGGAGTAA

Protein Analysis

93

Amino Acids

10.49

Weight (kDa)

5.29

Isoelectric Point (pI)

30.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 46
AciI CCGC 1 cut(s) 255
AcsI RAATTY 1 cut(s) 126
AflIII ACRYGT 1 cut(s) 117
AgsI TTSAA 2 cut(s) 65, 102
AjnI CCWGG 1 cut(s) 269
AoxI GGCC 1 cut(s) 267
ApoI RAATTY 1 cut(s) 126
Asp700I GAANNNNTTC 1 cut(s) 69
AspS9I GGNCC 1 cut(s) 267
BccI CCATC 1 cut(s) 2
BciT130I CCWGG 1 cut(s) 271
BciVI GTATCC 1 cut(s) 107
BfaI CTAG 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 192
BfuAI ACCTGC 1 cut(s) 46
BfuI GTATCC 1 cut(s) 107
BisI GCNGC 1 cut(s) 255
BlsI GCNGC 1 cut(s) 256
Bme1390I CCNGG 1 cut(s) 271
BmgT120I GGNCC 1 cut(s) 267
BmrFI CCNGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 270
BsaXI ACNNNNNCTCC 2 cut(s) 75, 105
BseBI CCWGG 1 cut(s) 271
BseDI CCNNGG 1 cut(s) 270
BseGI GGATG 1 cut(s) 10
BshFI GGCC 1 cut(s) 269
BsnI GGCC 1 cut(s) 269
Bsp143I GATC 1 cut(s) 177
BspACI CCGC 1 cut(s) 255
BspANI GGCC 1 cut(s) 269
BspMI ACCTGC 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 270
BssMI GATC 1 cut(s) 177
Bst2UI CCWGG 1 cut(s) 271
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BstNI CCWGG 1 cut(s) 271
BstNSI RCATGY 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 269
BstSFI CTRYAG 1 cut(s) 192
BsuI GTATCC 1 cut(s) 107
BsuRI GGCC 1 cut(s) 269
BtsCI GGATG 1 cut(s) 10
BveI ACCTGC 1 cut(s) 46
Cfr13I GGNCC 1 cut(s) 267
CviAII CATG 2 cut(s) 118, 147
CviJI RGCY 2 cut(s) 191, 269
CviKI_1 RGCY 2 cut(s) 191, 269
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
DraI TTTAAA 1 cut(s) 228
EcoRII CCWGG 1 cut(s) 269
FaeI CATG 2 cut(s) 121, 150
FaiI YATR 6 cut(s) 119, 141, 148, 170, 221, 246
FatI CATG 2 cut(s) 117, 146
Fnu4HI GCNGC 1 cut(s) 255
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 255
FspBI CTAG 1 cut(s) 156
GluI GCNGC 1 cut(s) 255
HaeIII GGCC 1 cut(s) 269
Hin1II CATG 2 cut(s) 121, 150
HinfI GANTC 1 cut(s) 160
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 1 cut(s) 133
HpyCH4V TGCA 3 cut(s) 55, 109, 236
Hsp92II CATG 2 cut(s) 121, 150
Kzo9I GATC 1 cut(s) 177
LpnPI CCDG 4 cut(s) 13, 41, 118, 256
LweI GCATC 1 cut(s) 42
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 74
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MboII GAAGA 3 cut(s) 46, 77, 191
MfeI CAATTG 1 cut(s) 102
MluCI AATT 3 cut(s) 19, 102, 126
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 1 cut(s) 57
MroXI GAANNNNTTC 1 cut(s) 69
MseI TTAA 2 cut(s) 18, 227
MspA1I CMGCKG 1 cut(s) 257
MspR9I CCNGG 1 cut(s) 271
MunI CAATTG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 271
NdeII GATC 1 cut(s) 177
NlaIII CATG 2 cut(s) 121, 150
NmuCI GTSAC 1 cut(s) 74
NspI RCATGY 1 cut(s) 121
PciI ACATGT 1 cut(s) 117
PdmI GAANNNNTTC 1 cut(s) 69
PfeI GAWTC 1 cut(s) 160
PkrI GCNGC 1 cut(s) 256
PscI ACATGT 1 cut(s) 117
Psp6I CCWGG 1 cut(s) 269
PspGI CCWGG 1 cut(s) 269
PspPI GGNCC 1 cut(s) 267
SaqAI TTAA 2 cut(s) 18, 227
SatI GCNGC 1 cut(s) 255
Sau3AI GATC 1 cut(s) 177
Sau96I GGNCC 1 cut(s) 267
ScrFI CCNGG 1 cut(s) 271
SetI ASST 1 cut(s) 60
SfaNI GCATC 1 cut(s) 42
SfcI CTRYAG 1 cut(s) 192
SgeI CNNG 7 cut(s) 40, 68, 122, 130, 145, 159, 168
Sse9I AATT 3 cut(s) 19, 102, 126
SsiI CCGC 1 cut(s) 255
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 269
TasI AATT 3 cut(s) 19, 102, 126
TauI GCSGC 1 cut(s) 257
TfiI GAWTC 1 cut(s) 160
Tru1I TTAA 2 cut(s) 18, 227
Tru9I TTAA 2 cut(s) 18, 227
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
XapI RAATTY 1 cut(s) 126
XceI RCATGY 1 cut(s) 121
XmnI GAANNNNTTC 1 cut(s) 69
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.