pycom17g27370

Xylosyltransferase 1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
25588447 .. 25588632
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g27370.1

Sequence Viewer

Length: 186 bp
ATGAGGAAGTGTGTGAATCATCACTCAGCAAGGGTGATTGGCAATAGAAATTGGGTTATTCCATTCATTACTGGCTTTATCATATTCATTACCCTCTTTTTCTTAAAAGGGTTTTGGCTTTGGAAGGAGATGGAGATCGGTGACAATGATTGGAGTTTGTCGCTGTGTGGATCGATCCCAGTGTAG

Protein Analysis

62

Amino Acids

7.16

Weight (kDa)

8.84

Isoelectric Point (pI)

15.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 169, 178
AlwI GGATC 2 cut(s) 169, 178
AsuHPI GGTGA 2 cut(s) 46, 152
BccI CCATC 1 cut(s) 124
BmrI ACTGGG 1 cut(s) 173
BmuI ACTGGG 1 cut(s) 173
Bsa29I ATCGAT 1 cut(s) 173
BsaBI GATNNNNATC 1 cut(s) 134
Bse1I ACTGG 2 cut(s) 76, 179
Bse8I GATNNNNATC 1 cut(s) 134
BseCI ATCGAT 1 cut(s) 173
BseJI GATNNNNATC 1 cut(s) 134
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 2 cut(s) 76, 179
BshVI ATCGAT 1 cut(s) 173
Bsp143I GATC 3 cut(s) 135, 170, 174
BspCNI CTCAG 1 cut(s) 38
BspDI ATCGAT 1 cut(s) 173
BspPI GGATC 2 cut(s) 169, 178
BsrI ACTGG 2 cut(s) 76, 179
BssMI GATC 3 cut(s) 135, 170, 174
BstDEI CTNAG 1 cut(s) 25
BstKTI GATC 3 cut(s) 138, 173, 177
BstMBI GATC 3 cut(s) 135, 170, 174
Bsu15I ATCGAT 1 cut(s) 173
BsuTUI ATCGAT 1 cut(s) 173
BtsIMutI CAGTG 1 cut(s) 186
ClaI ATCGAT 1 cut(s) 173
CviJI RGCY 2 cut(s) 75, 118
CviKI_1 RGCY 2 cut(s) 75, 118
DdeI CTNAG 1 cut(s) 25
DpnI GATC 3 cut(s) 137, 172, 176
DpnII GATC 3 cut(s) 135, 170, 174
FaiI YATR 1 cut(s) 83
HinfI GANTC 1 cut(s) 16
HphI GGTGA 2 cut(s) 46, 152
HpyAV CCTTC 1 cut(s) 118
HpyF3I CTNAG 1 cut(s) 25
Kzo9I GATC 3 cut(s) 135, 170, 174
LpnPI CCDG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 140
MalI GATC 3 cut(s) 137, 172, 176
MboI GATC 3 cut(s) 135, 170, 174
MluCI AATT 1 cut(s) 49
MnlI CCTC 1 cut(s) 104
MseI TTAA 1 cut(s) 104
NdeII GATC 3 cut(s) 135, 170, 174
NmuCI GTSAC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 16
SaqAI TTAA 1 cut(s) 104
Sau3AI GATC 3 cut(s) 135, 170, 174
SgeI CNNG 2 cut(s) 42, 84
Sse9I AATT 1 cut(s) 49
TaqI TCGA 1 cut(s) 173
TasI AATT 1 cut(s) 49
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TscAI CASTG 1 cut(s) 186
TseFI GTSAC 1 cut(s) 140
Tsp45I GTSAC 1 cut(s) 140
TspDTI ATGAA 2 cut(s) 55, 76
TspRI CASTG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.