RchiOBHm_Chr5g0004081

endoplasmic reticulum protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
2587709 .. 2587909
201 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGACGACATCAAGGAGGCTCACTAGTAGGAAGGTGGAGAGGTTTGACAAGAAGATTACGAAGAGAGGAGCTGTGCCTCAGAAAACAGCCAAAAGGGGGAGGGACTATCCTGTTGGCCCTATTTTGCTCGGCTTCTTTATCTTTGTGGTCATAGGATCATCTCTGTTTCAGATAATCAGGAGTGGCCTCAATTCAGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.44

Weight (kDa)

11.8

Isoelectric Point (pI)

49.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RAMP4 PF06624 5 - 61 1.2e-24 Ribosome associated membrane protein RAMP4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 163
AfiI CCNNNNNNNGG 1 cut(s) 96
AhlI ACTAGT 1 cut(s) 23
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AlwI GGATC 1 cut(s) 163
AoxI GGCC 2 cut(s) 115, 184
AspS9I GGNCC 1 cut(s) 116
BcuI ACTAGT 1 cut(s) 23
BfaI CTAG 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 81
BshFI GGCC 2 cut(s) 117, 186
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 116
BsnI GGCC 2 cut(s) 117, 186
Bsp143I GATC 1 cut(s) 155
BspANI GGCC 2 cut(s) 117, 186
BspCNI CTCAG 1 cut(s) 91
BspPI GGATC 1 cut(s) 163
BssMI GATC 1 cut(s) 155
Bst6I CTCTTC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BsuRI GGCC 2 cut(s) 117, 186
Cfr13I GGNCC 1 cut(s) 116
CviJI RGCY 6 cut(s) 19, 71, 89, 117, 132, 186
CviKI_1 RGCY 6 cut(s) 19, 71, 89, 117, 132, 186
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
FaiI YATR 1 cut(s) 152
FaqI GGGAC 1 cut(s) 116
FspBI CTAG 1 cut(s) 24
HaeIII GGCC 2 cut(s) 117, 186
Hpy188I TCNGA 2 cut(s) 81, 171
Hpy188III TCNNGA 1 cut(s) 178
HpyAV CCTTC 1 cut(s) 25
HpyF3I CTNAG 1 cut(s) 78
Kzo9I GATC 1 cut(s) 155
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 2 cut(s) 123, 163
MaeI CTAG 1 cut(s) 24
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 2 cut(s) 64, 73
MluCI AATT 1 cut(s) 190
MnlI CCTC 6 cut(s) 9, 33, 59, 87, 93, 197
NdeII GATC 1 cut(s) 155
NmeAIII GCCGAG 1 cut(s) 108
PspPI GGNCC 1 cut(s) 116
Sau3AI GATC 1 cut(s) 155
Sau96I GGNCC 1 cut(s) 116
SetI ASST 3 cut(s) 36, 44, 73
SgeI CNNG 6 cut(s) 24, 36, 61, 122, 140, 190
SpeI ACTAGT 1 cut(s) 23
Sse9I AATT 1 cut(s) 190
SspMI CTAG 1 cut(s) 24
TasI AATT 1 cut(s) 190
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.