RchiOBHm_Chr4g0391721

C2 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
7070294 .. 7072464
2171 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGCAGATTCTGCACTTGGGAATAAATTTTCTGATAGCTGATGATATGCTTGGAATACTTGCTGTCAAGCTAAAGAAAGGATCGGCTTTGGCTTTGTGGGCAGTGAAGACTCGGAAAGTATACACCCAAGATGAACTTGACGAGGTCCGCATTGAAGTAGCTGACTATTTGCAGACTTTGCTATAG

Protein Analysis

61

Amino Acids

6.9

Weight (kDa)

5.61

Isoelectric Point (pI)

13.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 120
AciI CCGC 1 cut(s) 148
AclWI GGATC 1 cut(s) 88
AcsI RAATTY 1 cut(s) 25
AgsI TTSAA 1 cut(s) 155
AluBI AGCT 3 cut(s) 38, 70, 161
AluI AGCT 3 cut(s) 38, 70, 161
AlwI GGATC 1 cut(s) 88
AlwNI CAGNNNCTG 1 cut(s) 10
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 145
AvaII GGWCC 1 cut(s) 145
BbsI GAAGAC 1 cut(s) 113
BfmI CTRYAG 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 145
BpiI GAAGAC 1 cut(s) 113
Bsp143I GATC 1 cut(s) 80
BspACI CCGC 1 cut(s) 148
BspPI GGATC 1 cut(s) 88
BssMI GATC 1 cut(s) 80
BssNAI GTATAC 1 cut(s) 121
Bst1107I GTATAC 1 cut(s) 121
BstAPI GCANNNNNTGC 2 cut(s) 10, 178
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BstMWI GCNNNNNNNGC 3 cut(s) 10, 98, 178
BstSFI CTRYAG 1 cut(s) 182
BstV2I GAAGAC 1 cut(s) 113
BstZ17I GTATAC 1 cut(s) 121
BtsI GCAGTG 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 108
CaiI CAGNNNCTG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 145
CviJI RGCY 5 cut(s) 38, 70, 86, 92, 161
CviKI_1 RGCY 5 cut(s) 38, 70, 86, 92, 161
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
Eco47I GGWCC 1 cut(s) 145
FaiI YATR 3 cut(s) 47, 121, 184
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FblI GTMKAC 1 cut(s) 120
HinfI GANTC 2 cut(s) 7, 109
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 2 cut(s) 33, 114
Hpy8I GTNNAC 1 cut(s) 121
HpyCH4V TGCA 3 cut(s) 4, 13, 172
HpyF10VI GCNNNNNNNGC 3 cut(s) 10, 98, 178
Kzo9I GATC 1 cut(s) 80
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 1 cut(s) 118
MluCI AATT 1 cut(s) 25
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 1 cut(s) 136
MwoI GCNNNNNNNGC 3 cut(s) 10, 98, 178
NdeII GATC 1 cut(s) 80
PfeI GAWTC 1 cut(s) 7
PflFI GACNNNGTC 1 cut(s) 143
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 145
PstNI CAGNNNCTG 1 cut(s) 10
PsyI GACNNNGTC 1 cut(s) 143
Sau3AI GATC 1 cut(s) 80
Sau96I GGNCC 1 cut(s) 145
SchI GAGTC 1 cut(s) 103
SetI ASST 4 cut(s) 40, 72, 147, 163
SfcI CTRYAG 1 cut(s) 182
SgeI CNNG 8 cut(s) 28, 62, 71, 79, 123, 140, 149, 154
SinI GGWCC 1 cut(s) 145
Sse9I AATT 1 cut(s) 25
SsiI CCGC 1 cut(s) 148
TasI AATT 1 cut(s) 25
TfiI GAWTC 1 cut(s) 7
TscAI CASTG 1 cut(s) 108
TspDTI ATGAA 1 cut(s) 147
TspRI CASTG 1 cut(s) 108
Tth111I GACNNNGTC 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 145
XapI RAATTY 1 cut(s) 25
XmiI GTMKAC 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.