Rroxscaffold_1G00045560

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
64652958 .. 64656706
3749 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00045560.1

Sequence Viewer

Length: 162 bp
ATGGACCTTGAAAGGCTTAAAGATCTTGTTCATGTTGTTGGAAAAGAAAGGCTTGTTTTAGACCTTAGCTGTAGAAAGAGGTGGGCGGTAAAGACGCGCAAATCATATAGCCAAACTCAAATTGATGAGGAAGTGGCTGATTATATACAGAGTTGGGTGTAG

Protein Analysis

53

Amino Acids

6.34

Weight (kDa)

7.89

Isoelectric Point (pI)

38.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 97
AciI CCGC 1 cut(s) 86
AgsI TTSAA 1 cut(s) 11
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
AspLEI GCGC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BfmI CTRYAG 1 cut(s) 70
BglII AGATCT 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
Bpu10I CCTNAGC 1 cut(s) 65
Bsh1236I CGCG 1 cut(s) 97
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 1 cut(s) 86
BspFNI CGCG 1 cut(s) 97
BssMI GATC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 65
BstFNI CGCG 1 cut(s) 97
BstHHI GCGC 1 cut(s) 99
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstSFI CTRYAG 1 cut(s) 70
BstUI CGCG 1 cut(s) 97
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
CfoI GCGC 1 cut(s) 99
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 103
CviAII CATG 1 cut(s) 32
CviJI RGCY 5 cut(s) 16, 52, 69, 111, 137
CviKI_1 RGCY 5 cut(s) 16, 52, 69, 111, 137
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 1 cut(s) 35
FaiI YATR 5 cut(s) 33, 106, 108, 144, 146
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FatI CATG 1 cut(s) 31
GlaI GCGC 1 cut(s) 98
HgaI GACGC 1 cut(s) 103
HhaI GCGC 1 cut(s) 99
Hin1II CATG 1 cut(s) 35
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 65
Hsp92II CATG 1 cut(s) 35
HspAI GCGC 1 cut(s) 97
Kzo9I GATC 1 cut(s) 22
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MflI RGATCY 1 cut(s) 22
MluCI AATT 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 19
MnlI CCTC 2 cut(s) 72, 121
MseI TTAA 1 cut(s) 18
MvnI CGCG 1 cut(s) 97
NdeII GATC 1 cut(s) 22
NlaIII CATG 1 cut(s) 35
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 22
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 1 cut(s) 22
Sau96I GGNCC 1 cut(s) 4
SetI ASST 4 cut(s) 9, 66, 71, 83
SfcI CTRYAG 1 cut(s) 70
SgeI CNNG 5 cut(s) 20, 38, 44, 65, 108
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 120
SsiI CCGC 1 cut(s) 86
TasI AATT 1 cut(s) 120
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 20
VpaK11BI GGWCC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.