Rh7BG461200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0007542
Physical Location & Seq
Reverse (-)
54708881 .. 54720132
11252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG461200.1

Sequence Viewer

Length: 357 bp
ATGGACATGATGTATATCGATAATTCAAAGGCAGCTAAATACGAATTCATTTCATTTCTTGTGGAAGCTGTGAGTAGGGCTTTTGGCCTAACTATAGAACATGTCATGAGCATGGATCATGGTCTGAAAGTTGCACAGTTGTCAAATAGGTATGCATGTCTGGAAATCGATGTCAAAAATAGTTCAGACTCCAAAGTTGCATATACTCAAGAACTTGGGAAAACCAGTTTTTTAAACTTCTTGACGCAGAAGTTTGACAGTTTAAGGATTCTGCTCCAAGGTGTTTGGGGGTTTAATTTTGAGATAGGGCTTCATGATCTTCATAGTCTCTGCAAGTGTTTAGGGTATTGCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.42

Weight (kDa)

6.03

Isoelectric Point (pI)

34.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 44
AflIII ACRYGT 1 cut(s) 100
AgsI TTSAA 1 cut(s) 27
AluBI AGCT 2 cut(s) 35, 68
AluI AGCT 2 cut(s) 35, 68
Alw26I GTCTC 1 cut(s) 332
AlwI GGATC 1 cut(s) 123
AoxI GGCC 1 cut(s) 85
ApeKI GCWGC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 44
BbvI GCAGC 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 332
BfmI CTRYAG 1 cut(s) 93
BisI GCNGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 34
BpuEI CTTGAG 1 cut(s) 192
Bsa29I ATCGAT 2 cut(s) 18, 168
BsaBI GATNNNNATC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 277
Bse1I ACTGG 1 cut(s) 225
Bse8I GATNNNNATC 1 cut(s) 14
BseCI ATCGAT 2 cut(s) 18, 168
BseDI CCNNGG 1 cut(s) 277
BseJI GATNNNNATC 1 cut(s) 14
BseNI ACTGG 1 cut(s) 225
BseXI GCAGC 1 cut(s) 44
BshFI GGCC 1 cut(s) 87
BshVI ATCGAT 2 cut(s) 18, 168
BsmAI GTCTC 1 cut(s) 332
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 2 cut(s) 115, 316
BspANI GGCC 1 cut(s) 87
BspDI ATCGAT 2 cut(s) 18, 168
BspHI TCATGA 2 cut(s) 105, 313
BspPI GGATC 1 cut(s) 123
BsrI ACTGG 1 cut(s) 225
BssECI CCNNGG 1 cut(s) 277
BssMI GATC 2 cut(s) 115, 316
BssT1I CCWWGG 1 cut(s) 277
Bst4CI ACNGT 2 cut(s) 138, 260
BstKTI GATC 2 cut(s) 118, 319
BstMAI GTCTC 1 cut(s) 332
BstMBI GATC 2 cut(s) 115, 316
BstNSI RCATGY 2 cut(s) 104, 159
BstSFI CTRYAG 1 cut(s) 93
BstV1I GCAGC 1 cut(s) 44
Bsu15I ATCGAT 2 cut(s) 18, 168
BsuRI GGCC 1 cut(s) 87
BsuTUI ATCGAT 2 cut(s) 18, 168
CciI TCATGA 2 cut(s) 105, 313
ClaI ATCGAT 2 cut(s) 18, 168
CseI GACGC 1 cut(s) 253
CviAII CATG 7 cut(s) 7, 101, 106, 112, 119, 156, 314
CviJI RGCY 5 cut(s) 35, 68, 80, 87, 310
CviKI_1 RGCY 5 cut(s) 35, 68, 80, 87, 310
DpnI GATC 2 cut(s) 117, 318
DpnII GATC 2 cut(s) 115, 316
DraI TTTAAA 1 cut(s) 234
Eco130I CCWWGG 1 cut(s) 277
EcoRI GAATTC 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 277
EcoT22I ATGCAT 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 277
FaeI CATG 7 cut(s) 10, 104, 109, 115, 122, 159, 317
FatI CATG 7 cut(s) 6, 100, 105, 111, 118, 155, 313
Fnu4HI GCNGC 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 33
GluI GCNGC 1 cut(s) 33
HaeIII GGCC 1 cut(s) 87
HgaI GACGC 1 cut(s) 253
Hin1II CATG 7 cut(s) 10, 104, 109, 115, 122, 159, 317
HinfI GANTC 2 cut(s) 188, 268
Hpy188I TCNGA 2 cut(s) 126, 187
Hpy188III TCNNGA 5 cut(s) 106, 161, 209, 241, 314
HpyCH4III ACNGT 2 cut(s) 138, 260
HpyCH4V TGCA 5 cut(s) 134, 155, 200, 333, 351
Hsp92II CATG 7 cut(s) 10, 104, 109, 115, 122, 159, 317
Kzo9I GATC 2 cut(s) 115, 316
LmnI GCTCC 1 cut(s) 279
LpnPI CCDG 2 cut(s) 146, 238
Lsp1109I GCAGC 1 cut(s) 44
MalI GATC 2 cut(s) 117, 318
MboI GATC 2 cut(s) 115, 316
MboII GAAGA 1 cut(s) 311
MluCI AATT 4 cut(s) 22, 44, 295, 352
MlyI GAGTC 1 cut(s) 182
Mph1103I ATGCAT 1 cut(s) 157
MseI TTAA 4 cut(s) 233, 263, 294, 355
MslI CAYNNNNRTG 1 cut(s) 110
NdeII GATC 2 cut(s) 115, 316
NlaIII CATG 7 cut(s) 10, 104, 109, 115, 122, 159, 317
NsiI ATGCAT 1 cut(s) 157
NspI RCATGY 2 cut(s) 104, 159
PagI TCATGA 2 cut(s) 105, 313
PciI ACATGT 1 cut(s) 100
PfeI GAWTC 1 cut(s) 268
PkrI GCNGC 1 cut(s) 34
PleI GAGTC 1 cut(s) 182
PpsI GAGTC 1 cut(s) 182
PscI ACATGT 1 cut(s) 100
RseI CAYNNNNRTG 1 cut(s) 110
SaqAI TTAA 4 cut(s) 233, 263, 294, 355
SatI GCNGC 1 cut(s) 33
Sau3AI GATC 2 cut(s) 115, 316
SchI GAGTC 1 cut(s) 182
SetI ASST 4 cut(s) 37, 70, 152, 283
SfcI CTRYAG 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 207
SmoI CTYRAG 1 cut(s) 207
Sse9I AATT 4 cut(s) 22, 44, 295, 352
StyI CCWWGG 1 cut(s) 277
TaaI ACNGT 2 cut(s) 138, 260
TaqI TCGA 2 cut(s) 18, 168
TasI AATT 4 cut(s) 22, 44, 295, 352
TfiI GAWTC 1 cut(s) 268
Tru1I TTAA 4 cut(s) 233, 263, 294, 355
Tru9I TTAA 4 cut(s) 233, 263, 294, 355
TseI GCWGC 1 cut(s) 32
TspDTI ATGAA 4 cut(s) 37, 42, 302, 311
XapI RAATTY 1 cut(s) 44
XceI RCATGY 2 cut(s) 104, 159
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.