Rroxscaffold_7G00194740

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
36781027 .. 36798562
17536 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00194740.1

Sequence Viewer

Length: 291 bp
ATGGACCTTGAAAGGCTTAAAGATCTTGTTCATGTTGTTGGAAAAGAAAGGCTTGTTTTAGACCTTAGCTGTAGAAAGAGGGAACAAGGGAGTAGTGGACTTCGACGAGTTACACCGGATGACTTCGATCCGGCGAATCCGTGCAAGGACCCGGTGGCGATGTTGGAGATGAGGGATCAAAATAGCGAAGCTAGGCCGAGATTCTTCGAGAGAAGCTCCGCTAATCCTACCATGTCAAAGGCATCAACCACCTCCAAAAGTACCGCCTCCTTTGCGATCGGTACTCTCTAG

Protein Analysis

96

Amino Acids

10.7

Weight (kDa)

8.74

Isoelectric Point (pI)

40.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 219, 264
AclWI GGATC 2 cut(s) 122, 183
AfaI GTAC 2 cut(s) 262, 283
AgsI TTSAA 1 cut(s) 11
AluBI AGCT 3 cut(s) 69, 191, 216
AluI AGCT 3 cut(s) 69, 191, 216
AlwI GGATC 2 cut(s) 122, 183
AoxI GGCC 1 cut(s) 194
AspS9I GGNCC 2 cut(s) 4, 148
AsuC2I CCSGG 1 cut(s) 152
AvaII GGWCC 2 cut(s) 4, 148
BcnI CCSGG 1 cut(s) 152
BfaI CTAG 2 cut(s) 192, 289
BfmI CTRYAG 1 cut(s) 70
BglII AGATCT 1 cut(s) 22
Bme1390I CCNGG 1 cut(s) 152
Bme18I GGWCC 2 cut(s) 4, 148
BmgT120I GGNCC 2 cut(s) 4, 148
BmiI GGNNCC 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 152
BmsI GCATC 1 cut(s) 251
BplI GAGNNNNNCTC 2 cut(s) 200, 232
Bpu10I CCTNAGC 1 cut(s) 65
BpuMI CCSGG 1 cut(s) 152
BsaWI WCCGGW 1 cut(s) 115
BseGI GGATG 1 cut(s) 124
Bsh1285I CGRYCG 1 cut(s) 279
BshFI GGCC 1 cut(s) 196
BsiEI CGRYCG 1 cut(s) 279
BsiSI CCGG 3 cut(s) 116, 131, 152
BsnI GGCC 1 cut(s) 196
Bsp143I GATC 4 cut(s) 22, 127, 175, 276
BspACI CCGC 2 cut(s) 219, 264
BspANI GGCC 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 150
BspPI GGATC 2 cut(s) 122, 183
BssMI GATC 4 cut(s) 22, 127, 175, 276
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 4 cut(s) 25, 130, 178, 279
BstMBI GATC 4 cut(s) 22, 127, 175, 276
BstMCI CGRYCG 1 cut(s) 279
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 150
BstSFI CTRYAG 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
BsuRI GGCC 1 cut(s) 196
BtgZI GCGATG 1 cut(s) 173
BtsCI GGATG 1 cut(s) 124
Cfr13I GGNCC 2 cut(s) 4, 148
Csp6I GTAC 2 cut(s) 261, 282
CviAII CATG 2 cut(s) 32, 232
CviJI RGCY 6 cut(s) 16, 52, 69, 191, 196, 216
CviKI_1 RGCY 6 cut(s) 16, 52, 69, 191, 196, 216
CviQI GTAC 2 cut(s) 261, 282
DdeI CTNAG 1 cut(s) 65
DpnI GATC 4 cut(s) 24, 129, 177, 278
DpnII GATC 4 cut(s) 22, 127, 175, 276
Eco47I GGWCC 2 cut(s) 4, 148
EcoO109I RGGNCCY 1 cut(s) 148
FaeI CATG 2 cut(s) 35, 235
FaiI YATR 2 cut(s) 33, 233
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FatI CATG 2 cut(s) 31, 231
FokI GGATG 1 cut(s) 131
FspBI CTAG 2 cut(s) 192, 289
HaeIII GGCC 1 cut(s) 196
HapII CCGG 3 cut(s) 116, 131, 152
Hin1II CATG 2 cut(s) 35, 235
HinfI GANTC 2 cut(s) 136, 201
HpaII CCGG 3 cut(s) 116, 131, 152
Hpy166II GTNNAC 1 cut(s) 98
Hpy188III TCNNGA 1 cut(s) 208
Hpy8I GTNNAC 1 cut(s) 98
Hpy99I CGWCG 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
HpyF3I CTNAG 1 cut(s) 65
Hsp92II CATG 2 cut(s) 35, 235
Kzo9I GATC 4 cut(s) 22, 127, 175, 276
LmnI GCTCC 1 cut(s) 221
LpnPI CCDG 3 cut(s) 129, 144, 165
LweI GCATC 1 cut(s) 251
MaeI CTAG 2 cut(s) 192, 289
MaeIII GTNAC 1 cut(s) 109
MalI GATC 4 cut(s) 24, 129, 177, 278
MboI GATC 4 cut(s) 22, 127, 175, 276
MboII GAAGA 1 cut(s) 196
MflI RGATCY 1 cut(s) 22
MmeI TCCRAC 2 cut(s) 19, 144
MnlI CCTC 4 cut(s) 72, 165, 262, 277
MseI TTAA 1 cut(s) 18
MspI CCGG 3 cut(s) 116, 131, 152
MspR9I CCNGG 1 cut(s) 152
MwoI GCNNNNNNNGC 1 cut(s) 272
NciI CCSGG 1 cut(s) 152
NdeII GATC 4 cut(s) 22, 127, 175, 276
NlaIII CATG 2 cut(s) 35, 235
NlaIV GGNNCC 1 cut(s) 150
NmeAIII GCCGAG 1 cut(s) 222
PfeI GAWTC 2 cut(s) 136, 201
Ple19I CGATCG 1 cut(s) 279
PpuMI RGGWCCY 1 cut(s) 148
Psp5II RGGWCCY 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 150
PspPI GGNCC 2 cut(s) 4, 148
PspPPI RGGWCCY 1 cut(s) 148
PsuI RGATCY 1 cut(s) 22
PvuI CGATCG 1 cut(s) 279
RsaI GTAC 2 cut(s) 262, 283
RsaNI GTAC 2 cut(s) 261, 282
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 4 cut(s) 22, 127, 175, 276
Sau96I GGNCC 2 cut(s) 4, 148
ScrFI CCNGG 1 cut(s) 152
SetI ASST 6 cut(s) 9, 66, 71, 193, 218, 254
SfaNI GCATC 1 cut(s) 251
SfcI CTRYAG 1 cut(s) 70
SinI GGWCC 2 cut(s) 4, 148
SsiI CCGC 2 cut(s) 219, 264
SspMI CTAG 2 cut(s) 192, 289
StyD4I CCNGG 1 cut(s) 150
TaqI TCGA 3 cut(s) 103, 126, 207
TfiI GAWTC 2 cut(s) 136, 201
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 20
TspGWI ACGGA 1 cut(s) 129
VpaK11BI GGWCC 2 cut(s) 4, 148
XspI CTAG 2 cut(s) 192, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.