RCHIOBHM_CHR0C22G0500401

No description available

Basic Information

Type: Sequence Only
Biological Identity
rosa_chinensis
Unknown
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGGTGGATTTCTCTGCCCCATTAGTGAGATTGCCATCATCAGATTGTTCAGAGGAGAAGATCAAACATGTCTTTTTCAGATTTCCTATTGATATCAGTACTGATTTAAGAGGTTACTTTGCTAATGAGGTATACCTAATTGCATATGGAACAAGAATAAGGTTGGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.47

Weight (kDa)

6.53

Isoelectric Point (pI)

25.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 132
AfaI GTAC 1 cut(s) 100
AflIII ACRYGT 1 cut(s) 67
AoxI GGCC 1 cut(s) 165
BccI CCATC 1 cut(s) 43
BmcAI AGTACT 1 cut(s) 100
BsaBI GATNNNNATC 1 cut(s) 34
Bse8I GATNNNNATC 1 cut(s) 34
BseJI GATNNNNATC 1 cut(s) 34
BseRI GAGGAG 1 cut(s) 68
BshFI GGCC 1 cut(s) 167
BsnI GGCC 1 cut(s) 167
Bsp143I GATC 1 cut(s) 60
BspANI GGCC 1 cut(s) 167
BssMI GATC 1 cut(s) 60
BssNAI GTATAC 1 cut(s) 133
Bst1107I GTATAC 1 cut(s) 133
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 71
BstZ17I GTATAC 1 cut(s) 133
BsuRI GGCC 1 cut(s) 167
Csp6I GTAC 1 cut(s) 99
CviAII CATG 1 cut(s) 68
CviJI RGCY 1 cut(s) 167
CviKI_1 RGCY 1 cut(s) 167
CviQI GTAC 1 cut(s) 99
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco32I GATATC 1 cut(s) 94
EcoRV GATATC 1 cut(s) 94
FaeI CATG 1 cut(s) 71
FaiI YATR 4 cut(s) 69, 133, 145, 147
FatI CATG 1 cut(s) 67
FauNDI CATATG 1 cut(s) 145
FblI GTMKAC 1 cut(s) 132
HaeIII GGCC 1 cut(s) 167
Hin1II CATG 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 3 cut(s) 43, 52, 80
Hpy8I GTNNAC 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 143
Hsp92II CATG 1 cut(s) 71
Kzo9I GATC 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 1 cut(s) 70
MluCI AATT 1 cut(s) 138
MnlI CCTC 3 cut(s) 46, 104, 121
MseI TTAA 1 cut(s) 107
NdeI CATATG 1 cut(s) 145
NdeII GATC 1 cut(s) 60
NlaIII CATG 1 cut(s) 71
NspI RCATGY 1 cut(s) 71
PciI ACATGT 1 cut(s) 67
PscI ACATGT 1 cut(s) 67
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 1 cut(s) 60
ScaI AGTACT 1 cut(s) 100
SetI ASST 4 cut(s) 115, 132, 138, 164
SgeI CNNG 2 cut(s) 80, 165
Sse9I AATT 1 cut(s) 138
TasI AATT 1 cut(s) 138
TatI WGTACW 1 cut(s) 98
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
XceI RCATGY 1 cut(s) 71
XmiI GTMKAC 1 cut(s) 132
ZrmI AGTACT 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.