Rroxscaffold_1G00066350

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
87870308 .. 87878114
7807 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00066350.1

Sequence Viewer

Length: 276 bp
ATGAAAGTCAACATCATGAAAGGCTTGATTCTGCACTTGGGAATAAATTTTCTGATAGCTGATGATATGCTTGGAATACTTGCTGTCAAGCTAAAGAAAGGATCGGCGTTGGAATTTGGGCGAAGTTGCATATTACCGGCATGCATGTTGAAGGGAAGGATCAAGCGACGCTTTCACAATACCGGGACAGAAGATTTCCTGGATCGCAAGAGGAATTCGAACAAGCACTTGTGTCATCAATTAACAACCGCCTACGTTGGGAACATGTCGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.28

Weight (kDa)

10.03

Isoelectric Point (pI)

56.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 249
AclWI GGATC 3 cut(s) 109, 167, 210
AcsI RAATTY 3 cut(s) 46, 113, 214
AfiI CCNNNNNNNGG 1 cut(s) 258
AflIII ACRYGT 1 cut(s) 264
AgsI TTSAA 1 cut(s) 151
AjnI CCWGG 1 cut(s) 198
AluBI AGCT 2 cut(s) 59, 91
AluI AGCT 2 cut(s) 59, 91
AlwI GGATC 3 cut(s) 109, 167, 210
ApoI RAATTY 3 cut(s) 46, 113, 214
AsuC2I CCSGG 1 cut(s) 184
AsuII TTCGAA 1 cut(s) 218
BciT130I CCWGG 1 cut(s) 200
BcnI CCSGG 1 cut(s) 184
Bme1390I CCNGG 2 cut(s) 184, 200
BmrFI CCNGG 2 cut(s) 184, 200
Bpu14I TTCGAA 1 cut(s) 218
BpuMI CCSGG 1 cut(s) 184
Bsc4I CCNNNNNNNGG 1 cut(s) 258
Bse118I RCCGGY 1 cut(s) 136
BseBI CCWGG 1 cut(s) 200
BseLI CCNNNNNNNGG 1 cut(s) 258
BsgI GTGCAG 1 cut(s) 17
BsiSI CCGG 2 cut(s) 137, 183
BslFI GGGAC 1 cut(s) 199
BslI CCNNNNNNNGG 1 cut(s) 258
BsmFI GGGAC 1 cut(s) 199
Bsp119I TTCGAA 1 cut(s) 218
Bsp143I GATC 3 cut(s) 101, 159, 202
BspACI CCGC 1 cut(s) 249
BspHI TCATGA 1 cut(s) 15
BspPI GGATC 3 cut(s) 109, 167, 210
BspT104I TTCGAA 1 cut(s) 218
BsrFI RCCGGY 1 cut(s) 136
BssAI RCCGGY 1 cut(s) 136
BssMI GATC 3 cut(s) 101, 159, 202
Bst2UI CCWGG 1 cut(s) 200
BstBI TTCGAA 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 142
BstKTI GATC 3 cut(s) 104, 162, 205
BstMBI GATC 3 cut(s) 101, 159, 202
BstNI CCWGG 1 cut(s) 200
BstNSI RCATGY 3 cut(s) 144, 148, 268
BstSCI CCNGG 2 cut(s) 182, 198
Cac8I GCNNGC 1 cut(s) 142
CciI TCATGA 1 cut(s) 15
Cfr10I RCCGGY 1 cut(s) 136
CseI GACGC 1 cut(s) 177
CviAII CATG 4 cut(s) 16, 141, 145, 265
CviJI RGCY 3 cut(s) 24, 59, 91
CviKI_1 RGCY 3 cut(s) 24, 59, 91
DpnI GATC 3 cut(s) 103, 161, 204
DpnII GATC 3 cut(s) 101, 159, 202
EcoRI GAATTC 1 cut(s) 214
EcoRII CCWGG 1 cut(s) 198
EcoT22I ATGCAT 1 cut(s) 146
FaeI CATG 4 cut(s) 19, 144, 148, 268
FaiI YATR 6 cut(s) 17, 68, 131, 142, 146, 266
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FaqI GGGAC 1 cut(s) 199
FatI CATG 4 cut(s) 15, 140, 144, 264
HapII CCGG 2 cut(s) 137, 183
HgaI GACGC 1 cut(s) 177
Hin1II CATG 4 cut(s) 19, 144, 148, 268
HincII GTYRAC 1 cut(s) 10
HindII GTYRAC 1 cut(s) 10
HinfI GANTC 1 cut(s) 28
HpaII CCGG 2 cut(s) 137, 183
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 16
Hpy8I GTNNAC 1 cut(s) 10
Hpy99I CGWCG 1 cut(s) 171
HpyAV CCTTC 2 cut(s) 145, 150
HpyCH4IV ACGT 1 cut(s) 255
HpyCH4V TGCA 3 cut(s) 34, 129, 144
HpySE526I ACGT 1 cut(s) 255
Hsp92II CATG 4 cut(s) 19, 144, 148, 268
Kzo9I GATC 3 cut(s) 101, 159, 202
LpnPI CCDG 4 cut(s) 150, 185, 196, 212
MaeII ACGT 1 cut(s) 255
MalI GATC 3 cut(s) 103, 161, 204
MboI GATC 3 cut(s) 101, 159, 202
MboII GAAGA 1 cut(s) 203
MluCI AATT 4 cut(s) 46, 113, 214, 239
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 1 cut(s) 204
Mph1103I ATGCAT 1 cut(s) 146
MseI TTAA 1 cut(s) 242
MspI CCGG 2 cut(s) 137, 183
MspR9I CCNGG 2 cut(s) 184, 200
MvaI CCWGG 1 cut(s) 200
NciI CCSGG 1 cut(s) 184
NdeII GATC 3 cut(s) 101, 159, 202
NlaIII CATG 4 cut(s) 19, 144, 148, 268
NsiI ATGCAT 1 cut(s) 146
NspI RCATGY 3 cut(s) 144, 148, 268
NspV TTCGAA 1 cut(s) 218
PaeI GCATGC 1 cut(s) 144
PagI TCATGA 1 cut(s) 15
PciI ACATGT 1 cut(s) 264
PfeI GAWTC 1 cut(s) 28
PfoI TCCNGGA 1 cut(s) 198
PscI ACATGT 1 cut(s) 264
Psp6I CCWGG 1 cut(s) 198
PspGI CCWGG 1 cut(s) 198
SaqAI TTAA 1 cut(s) 242
Sau3AI GATC 3 cut(s) 101, 159, 202
ScrFI CCNGG 2 cut(s) 184, 200
SetI ASST 3 cut(s) 61, 93, 258
SfuI TTCGAA 1 cut(s) 218
SphI GCATGC 1 cut(s) 144
Sse9I AATT 4 cut(s) 46, 113, 214, 239
SsiI CCGC 1 cut(s) 249
StyD4I CCNGG 2 cut(s) 182, 198
TaiI ACGT 1 cut(s) 258
TaqI TCGA 1 cut(s) 218
TasI AATT 4 cut(s) 46, 113, 214, 239
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TspDTI ATGAA 2 cut(s) 17, 32
XapI RAATTY 3 cut(s) 46, 113, 214
XceI RCATGY 3 cut(s) 144, 148, 268
Zsp2I ATGCAT 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.