RchiOBHm_Chr4g0394401

Phosphoinositide phospholipase C

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
10045414 .. 10048655
3242 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGCACAAGGGCGCAAATGTTGAGGTTTTTTATCCTAAAAGGACCTTGATAGTTGCAAAGACATTGAAGGTGAAAGCATACATGGGGAATAAATGGCACTTGGATTTTAGTCAAACACACTTCCATTCGTTCGCCCCAGACTTCTACACAAAAGTTAGTAAGATCCGTCTTTGTTTTTCTGGTAATTCAAGAATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.59

Weight (kDa)

10.09

Isoelectric Point (pI)

43.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 157
AcsI RAATTY 1 cut(s) 192
AgsI TTSAA 2 cut(s) 67, 189
AlwI GGATC 1 cut(s) 157
ApoI RAATTY 1 cut(s) 192
AspLEI GCGC 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 82
AvaII GGWCC 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 162
BspPI GGATC 1 cut(s) 157
BssMI GATC 1 cut(s) 162
BstHHI GCGC 1 cut(s) 14
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
BstX2I RGATCY 1 cut(s) 162
BstYI RGATCY 1 cut(s) 162
CfoI GCGC 1 cut(s) 14
Cfr13I GGNCC 1 cut(s) 42
CviAII CATG 1 cut(s) 82
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 42
EcoO109I RGGNCCY 1 cut(s) 42
FaeI CATG 1 cut(s) 85
FaiI YATR 2 cut(s) 79, 83
FatI CATG 1 cut(s) 81
GlaI GCGC 1 cut(s) 13
HhaI GCGC 1 cut(s) 14
Hin1II CATG 1 cut(s) 85
Hin6I GCGC 1 cut(s) 12
HinP1I GCGC 1 cut(s) 12
HphI GGTGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 189
HpyAV CCTTC 1 cut(s) 61
HpyCH4V TGCA 2 cut(s) 4, 56
Hsp92II CATG 1 cut(s) 85
HspAI GCGC 1 cut(s) 12
Kzo9I GATC 1 cut(s) 162
LpnPI CCDG 2 cut(s) 150, 165
MalI GATC 1 cut(s) 164
MboI GATC 1 cut(s) 162
MflI RGATCY 1 cut(s) 162
MluCI AATT 2 cut(s) 184, 192
MnlI CCTC 1 cut(s) 16
NdeII GATC 1 cut(s) 162
NlaIII CATG 1 cut(s) 85
PpuMI RGGWCCY 1 cut(s) 42
Psp5II RGGWCCY 1 cut(s) 42
PspPI GGNCC 1 cut(s) 42
PspPPI RGGWCCY 1 cut(s) 42
PsuI RGATCY 1 cut(s) 162
Sau3AI GATC 1 cut(s) 162
Sau96I GGNCC 1 cut(s) 42
SetI ASST 3 cut(s) 27, 47, 72
SgeI CNNG 6 cut(s) 19, 58, 94, 112, 149, 192
SinI GGWCC 1 cut(s) 42
Sse9I AATT 2 cut(s) 184, 192
TasI AATT 2 cut(s) 184, 192
TspGWI ACGGA 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 42
XapI RAATTY 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.