Rmu_co8189356.1_g000001

Phosphoinositide phospholipase C

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8189356.1
Physical Location & Seq
Forward (+)
1 .. 696
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8189356.1_g000001.1.cds

Sequence Viewer

Length: 339 bp
aagaacattttaagggtgtatccaaaaggaactcggttcaactcctccaactacaagccgcttattggctggatgcatggtgctcaaatggttgcatttaatatgcagggatatggtaaatctctttggctgatgcatgggatgtttagagcaaatgggggctgtggttatgtgaaaaagcctgattttgttatgaacgataagcagattttcgatcctaaagcaaaattgccagtaaagaagactttaaaggtgaaagtatatatgggagatggttggcatctggatttcaaacaaacacactttgatttatattcaccaccagatttttacaccagg

Protein Analysis

113

Amino Acids

13.17

Weight (kDa)

9.88

Isoelectric Point (pI)

40.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 59
AclWI GGATC 1 cut(s) 209
AfiI CCNNNNNNNGG 1 cut(s) 65
AgsI TTSAA 2 cut(s) 40, 292
Alw21I GWGCWC 1 cut(s) 85
AlwI GGATC 1 cut(s) 209
AsuHPI GGTGA 2 cut(s) 265, 309
BbsI GAAGAC 1 cut(s) 248
Bbv12I GWGCWC 1 cut(s) 85
BccI CCATC 1 cut(s) 266
BciT130I CCWGG 1 cut(s) 337
BciVI GTATCC 1 cut(s) 30
BfuI GTATCC 1 cut(s) 30
BisI GCNGC 1 cut(s) 59
BlsI GCNGC 1 cut(s) 60
Bme1390I CCNGG 1 cut(s) 337
BmrFI CCNGG 1 cut(s) 337
BmsI GCATC 3 cut(s) 63, 123, 289
BpiI GAAGAC 1 cut(s) 248
Bsc4I CCNNNNNNNGG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 233
BseBI CCWGG 1 cut(s) 337
BseGI GGATG 2 cut(s) 78, 147
BseLI CCNNNNNNNGG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 233
BseRI GAGGAG 1 cut(s) 34
BsiHKAI GWGCWC 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 65
Bsp1286I GDGCHC 1 cut(s) 85
Bsp143I GATC 1 cut(s) 214
BspACI CCGC 1 cut(s) 59
BspPI GGATC 1 cut(s) 209
BsrI ACTGG 1 cut(s) 233
BssMI GATC 1 cut(s) 214
Bst2UI CCWGG 1 cut(s) 337
BstF5I GGATG 2 cut(s) 78, 147
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BstNI CCWGG 1 cut(s) 337
BstV2I GAAGAC 1 cut(s) 248
BsuI GTATCC 1 cut(s) 30
BtsCI GGATG 2 cut(s) 78, 147
CviAII CATG 2 cut(s) 77, 137
CviJI RGCY 5 cut(s) 58, 69, 130, 162, 181
CviKI_1 RGCY 5 cut(s) 58, 69, 130, 162, 181
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
DraI TTTAAA 1 cut(s) 249
EcoT22I ATGCAT 2 cut(s) 78, 138
FaeI CATG 2 cut(s) 80, 140
FatI CATG 2 cut(s) 76, 136
Fnu4HI GCNGC 1 cut(s) 59
FokI GGATG 2 cut(s) 85, 154
Fsp4HI GCNGC 1 cut(s) 59
GluI GCNGC 1 cut(s) 59
Hin1II CATG 2 cut(s) 80, 140
HphI GGTGA 2 cut(s) 265, 309
Hpy188III TCNNGA 1 cut(s) 284
HpyCH4V TGCA 4 cut(s) 76, 95, 106, 136
Hsp92II CATG 2 cut(s) 80, 140
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 6 cut(s) 55, 92, 195, 246, 269, 322
LweI GCATC 3 cut(s) 63, 123, 289
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 1 cut(s) 253
MhlI GDGCHC 1 cut(s) 85
MluCI AATT 1 cut(s) 227
MmeI TCCRAC 1 cut(s) 72
MnlI CCTC 1 cut(s) 55
Mph1103I ATGCAT 2 cut(s) 78, 138
MseI TTAA 3 cut(s) 11, 99, 248
MspR9I CCNGG 1 cut(s) 337
MvaI CCWGG 1 cut(s) 337
NdeII GATC 1 cut(s) 214
NlaIII CATG 2 cut(s) 80, 140
NsiI ATGCAT 2 cut(s) 78, 138
PkrI GCNGC 1 cut(s) 60
SaqAI TTAA 3 cut(s) 11, 99, 248
SatI GCNGC 1 cut(s) 59
Sau3AI GATC 1 cut(s) 214
ScrFI CCNGG 1 cut(s) 337
SduI GDGCHC 1 cut(s) 85
SetI ASST 1 cut(s) 255
SfaNI GCATC 3 cut(s) 63, 123, 289
Sse9I AATT 1 cut(s) 227
SsiI CCGC 1 cut(s) 59
TaqI TCGA 1 cut(s) 213
TasI AATT 1 cut(s) 227
TauI GCSGC 1 cut(s) 61
Tru1I TTAA 3 cut(s) 11, 99, 248
Tru9I TTAA 3 cut(s) 11, 99, 248
TspDTI ATGAA 1 cut(s) 209
Zsp2I ATGCAT 2 cut(s) 78, 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.