Rroxscaffold_5G00339410

Phosphoinositide phospholipase C

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
7820674 .. 7826619
5946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00339410.1

Sequence Viewer

Length: 174 bp
ATGCACAAGGGCTCAAATGATGAGGTTTTTGATCCTAAAAGGACCTTGATAGTGGCAAAGACATTGAAGGTGAAAGCATACATGGGGAATAAATGGCACTTGGATTTTTTTCAAACACACTTCGATTCGTTCGCCCCACAAACTTCTACACAAAAAAGTTGTTTTTCAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.61

Weight (kDa)

8.89

Isoelectric Point (pI)

53.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 26
AgsI TTSAA 2 cut(s) 67, 113
AlwI GGATC 1 cut(s) 26
AspS9I GGNCC 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 82
AvaII GGWCC 1 cut(s) 42
BanII GRGCYC 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 31
BspPI GGATC 1 cut(s) 26
BssMI GATC 1 cut(s) 31
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 42
CviAII CATG 1 cut(s) 82
CviJI RGCY 1 cut(s) 12
CviKI_1 RGCY 1 cut(s) 12
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Eco24I GRGCYC 1 cut(s) 14
Eco47I GGWCC 1 cut(s) 42
EcoO109I RGGNCCY 1 cut(s) 42
EcoT38I GRGCYC 1 cut(s) 14
FaeI CATG 1 cut(s) 85
FaiI YATR 2 cut(s) 79, 83
FatI CATG 1 cut(s) 81
FriOI GRGCYC 1 cut(s) 14
Hin1II CATG 1 cut(s) 85
HinfI GANTC 1 cut(s) 125
HphI GGTGA 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 61
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 85
Kzo9I GATC 1 cut(s) 31
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MhlI GDGCHC 1 cut(s) 14
MnlI CCTC 1 cut(s) 16
MseI TTAA 1 cut(s) 172
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 125
PpuMI RGGWCCY 1 cut(s) 42
Psp5II RGGWCCY 1 cut(s) 42
PspPI GGNCC 1 cut(s) 42
PspPPI RGGWCCY 1 cut(s) 42
SaqAI TTAA 1 cut(s) 172
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 1 cut(s) 42
SduI GDGCHC 1 cut(s) 14
SetI ASST 3 cut(s) 27, 47, 72
SgeI CNNG 4 cut(s) 19, 58, 94, 112
SinI GGWCC 1 cut(s) 42
TaqI TCGA 1 cut(s) 123
TfiI GAWTC 1 cut(s) 125
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
VpaK11BI GGWCC 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.