RchiOBHm_Chr4g0409891

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
33492156 .. 33492476
321 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 321 bp
ATGGGGAGCTTGAAATATTTGGTGGATCTCGAGTTGAGCCACAATCAACTAAGTGGTTCAATTCCGACAACATTGGGTGATCTGACCGACCTTACCACTCTTTATCTTCATTCAAATAATCTCAATGGTACCATTCCAAAAGAGTTAGGGAACCTGAAATCTTTGGTGGATCTACAATTAAGCATCAATCAGCCCAGTGGTTCAATTTCGGCAACATTGGGTGATCTAACCATCCTTACCACTCTTTTTCTTCATTCAAATTATCTCTTTGAGACCATTCTAAAAGAGTTAGGGAACCTACAATCTTTGGTGGATCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

106

Amino Acids

11.5

Weight (kDa)

4.59

Isoelectric Point (pI)

17.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 2 - 105 2.8e-09 Leucine-rich repeat region
LRR_8 PF13855 7 - 64 6.1e-07 Leucine rich repeat
LRR_4 PF12799 9 - 45 1e-05 Leucine Rich repeats (2 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 128
AccB1I GGYRCC 1 cut(s) 128
AclWI GGATC 2 cut(s) 33, 177
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 5 cut(s) 13, 60, 114, 204, 258
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 266
AlwI GGATC 2 cut(s) 33, 177
Ama87I CYCGRG 1 cut(s) 29
Asp718I GGTACC 1 cut(s) 128
AsuHPI GGTGA 2 cut(s) 89, 233
AvaI CYCGRG 1 cut(s) 29
BanI GGYRCC 1 cut(s) 128
BccI CCATC 1 cut(s) 239
BcoDI GTCTC 1 cut(s) 266
BmeT110I CYCGRG 1 cut(s) 29
BmiI GGNNCC 3 cut(s) 130, 152, 296
BmrI ACTGGG 1 cut(s) 189
BmsI GCATC 1 cut(s) 192
BmuI ACTGGG 1 cut(s) 189
BsaI GGTCTC 1 cut(s) 266
Bse1I ACTGG 1 cut(s) 195
BseGI GGATG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 195
BshNI GGYRCC 1 cut(s) 128
BsiHKCI CYCGRG 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 266
Bso31I GGTCTC 1 cut(s) 266
BsoBI CYCGRG 1 cut(s) 29
Bsp143I GATC 5 cut(s) 25, 79, 169, 223, 313
BspLI GGNNCC 3 cut(s) 130, 152, 296
BspPI GGATC 2 cut(s) 33, 177
BspT107I GGYRCC 1 cut(s) 128
BspTNI GGTCTC 1 cut(s) 266
BsrI ACTGG 1 cut(s) 195
BssMI GATC 5 cut(s) 25, 79, 169, 223, 313
BstDEI CTNAG 1 cut(s) 50
BstF5I GGATG 1 cut(s) 231
BstKTI GATC 5 cut(s) 28, 82, 172, 226, 316
BstMAI GTCTC 1 cut(s) 266
BstMBI GATC 5 cut(s) 25, 79, 169, 223, 313
BstX2I RGATCY 3 cut(s) 25, 169, 313
BstYI RGATCY 3 cut(s) 25, 169, 313
BtsCI GGATG 1 cut(s) 231
BtsIMutI CAGTG 1 cut(s) 202
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 3 cut(s) 9, 39, 193
CviKI_1 RGCY 3 cut(s) 9, 39, 193
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 1 cut(s) 50
DpnI GATC 5 cut(s) 27, 81, 171, 225, 315
DpnII GATC 5 cut(s) 25, 79, 169, 223, 313
Eco31I GGTCTC 1 cut(s) 266
Eco88I CYCGRG 1 cut(s) 29
FaiI YATR 1 cut(s) 319
FokI GGATG 1 cut(s) 218
HphI GGTGA 2 cut(s) 89, 233
Hpy188I TCNGA 2 cut(s) 66, 84
Hpy188III TCNNGA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 50
KpnI GGTACC 1 cut(s) 132
Kzo9I GATC 5 cut(s) 25, 79, 169, 223, 313
LmnI GCTCC 1 cut(s) 6
LpnPI CCDG 2 cut(s) 167, 208
LweI GCATC 1 cut(s) 192
MalI GATC 5 cut(s) 27, 81, 171, 225, 315
MboI GATC 5 cut(s) 25, 79, 169, 223, 313
MboII GAAGA 2 cut(s) 98, 242
MflI RGATCY 3 cut(s) 25, 169, 313
MluCI AATT 4 cut(s) 60, 176, 204, 259
MmeI TCCRAC 1 cut(s) 89
MseI TTAA 1 cut(s) 179
NdeII GATC 5 cut(s) 25, 79, 169, 223, 313
NlaIV GGNNCC 3 cut(s) 130, 152, 296
PaeR7I CTCGAG 1 cut(s) 29
PspN4I GGNNCC 3 cut(s) 130, 152, 296
PsuI RGATCY 3 cut(s) 25, 169, 313
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SaqAI TTAA 1 cut(s) 179
Sau3AI GATC 5 cut(s) 25, 79, 169, 223, 313
SetI ASST 4 cut(s) 11, 93, 156, 300
SfaNI GCATC 1 cut(s) 192
Sfr274I CTCGAG 1 cut(s) 29
SgeI CNNG 5 cut(s) 22, 41, 43, 166, 207
SlaI CTCGAG 1 cut(s) 29
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 4 cut(s) 60, 176, 204, 259
SspI AATATT 1 cut(s) 17
TaqI TCGA 1 cut(s) 30
TaqII GACCGA 1 cut(s) 101
TasI AATT 4 cut(s) 60, 176, 204, 259
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TscAI CASTG 1 cut(s) 202
TspDTI ATGAA 2 cut(s) 98, 242
TspRI CASTG 1 cut(s) 202
XhoI CTCGAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.