RchiOBHm_Chr4g0412201

Telomere length regulation protein TEL2 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
35960822 .. 35963510
2689 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 276 bp
ATGGAGGTTTTGGCAGAAGTGGTGAGCTTCTGCATATATCTCATATGTTATGCTCTCTTGTTGCGTGCAGATGTCGCTTCCAATTGGCTTGCTTGTTTCCCATTTTCAGCACGAAAACATGTGTATGTTGTTTTCTTTGTTAATGGACTTGCCACCGAGGTTGTTCAGATTTTGGTCAATTATCTACAGCAAAGTAGAAGTGGTGACCTTGATGTCAATGTTGTTCACTCCAATATGAAAAGGGATGGATTGAGAATTGAGGTCCAATTATTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.34

Weight (kDa)

6.02

Isoelectric Point (pI)

52.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 212
AflIII ACRYGT 1 cut(s) 118
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 262
AsuHPI GGTGA 2 cut(s) 34, 215
AvaII GGWCC 1 cut(s) 262
BccI CCATC 1 cut(s) 239
BfmI CTRYAG 1 cut(s) 185
Bme18I GGWCC 1 cut(s) 262
BmgT120I GGNCC 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 250
BsgI GTGCAG 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 156
BstC8I GCNNGC 2 cut(s) 66, 90
BstEII GGTNACC 1 cut(s) 203
BstF5I GGATG 1 cut(s) 250
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNSI RCATGY 1 cut(s) 122
BstPI GGTNACC 1 cut(s) 203
BstSFI CTRYAG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 250
Cac8I GCNNGC 2 cut(s) 66, 90
Cfr13I GGNCC 1 cut(s) 262
CspCI CAANNNNNGTGG 2 cut(s) 142, 177
CviAII CATG 1 cut(s) 119
CviJI RGCY 2 cut(s) 27, 88
CviKI_1 RGCY 2 cut(s) 27, 88
DrdI GACNNNNNNGTC 1 cut(s) 212
DseDI GACNNNNNNGTC 1 cut(s) 212
Eco47I GGWCC 1 cut(s) 262
Eco91I GGTNACC 1 cut(s) 203
EcoO65I GGTNACC 1 cut(s) 203
FaeI CATG 1 cut(s) 122
FaiI YATR 9 cut(s) 35, 37, 44, 46, 51, 120, 126, 236, 274
FatI CATG 1 cut(s) 118
FauNDI CATATG 1 cut(s) 44
FokI GGATG 1 cut(s) 257
Hin1II CATG 1 cut(s) 122
HphI GGTGA 2 cut(s) 34, 215
Hpy166II GTNNAC 1 cut(s) 226
Hpy188I TCNGA 1 cut(s) 168
Hpy8I GTNNAC 1 cut(s) 226
HpyCH4V TGCA 2 cut(s) 33, 68
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
Hsp92II CATG 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 203
MfeI CAATTG 1 cut(s) 82
MluCI AATT 4 cut(s) 82, 178, 255, 266
MnlI CCTC 2 cut(s) 151, 253
MseI TTAA 1 cut(s) 141
MslI CAYNNNNRTG 1 cut(s) 123
MunI CAATTG 1 cut(s) 82
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeI CATATG 1 cut(s) 44
NlaIII CATG 1 cut(s) 122
NmuCI GTSAC 1 cut(s) 203
NspI RCATGY 1 cut(s) 122
PciI ACATGT 1 cut(s) 118
PscI ACATGT 1 cut(s) 118
PspEI GGTNACC 1 cut(s) 203
PspPI GGNCC 1 cut(s) 262
RseI CAYNNNNRTG 1 cut(s) 123
SaqAI TTAA 1 cut(s) 141
Sau96I GGNCC 1 cut(s) 262
SetI ASST 5 cut(s) 9, 29, 162, 210, 264
SfcI CTRYAG 1 cut(s) 185
SgeI CNNG 9 cut(s) 70, 77, 101, 105, 123, 131, 161, 169, 221
SinI GGWCC 1 cut(s) 262
SmiMI CAYNNNNRTG 1 cut(s) 123
Sse9I AATT 4 cut(s) 82, 178, 255, 266
TasI AATT 4 cut(s) 82, 178, 255, 266
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TseFI GTSAC 1 cut(s) 203
Tsp45I GTSAC 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 251
VpaK11BI GGWCC 1 cut(s) 262
XceI RCATGY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.