RchiOBHm_Chr6g0278011

Telomere length regulation protein TEL2 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
40804840 .. 40807144
2305 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24941

Sequence Viewer

Length: 225 bp
ATGGGGTGCTCCAGATGGCTAGAGAATTTGGCGGCTCTTTCCAGTCTGAAGATTATACAAATGAAAATCTCAATTACCGTTCAGCTTCTTTCCCTAGCAGAAGAAGGGAATATGGAGTTGTTAGATGAAGGAGCCTTCCGTAAAAGTGACATGCAGGGGACCTTACTGTTTGTTGGGGAAACATTTTCTCGTATATCTCGACTTGGATCTGTAGCTTGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.12

Weight (kDa)

5.22

Isoelectric Point (pI)

31.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 214
AcsI RAATTY 1 cut(s) 25
AcuI CTGAAG 1 cut(s) 68
AluBI AGCT 2 cut(s) 85, 215
AluI AGCT 2 cut(s) 85, 215
Alw21I GWGCWC 1 cut(s) 11
AlwI GGATC 1 cut(s) 214
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 159
AvaII GGWCC 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 11
BccI CCATC 1 cut(s) 9
BfaI CTAG 2 cut(s) 20, 95
BfmI CTRYAG 1 cut(s) 210
BisI GCNGC 1 cut(s) 33
BlsI GCNGC 1 cut(s) 34
Bme18I GGWCC 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 159
BmiI GGNNCC 2 cut(s) 133, 160
Bse1I ACTGG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 11
BslFI GGGAC 1 cut(s) 172
BsmFI GGGAC 1 cut(s) 172
Bsp1286I GDGCHC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 206
BspACI CCGC 1 cut(s) 32
BspLI GGNNCC 2 cut(s) 133, 160
BspPI GGATC 1 cut(s) 214
BsrI ACTGG 1 cut(s) 42
BssMI GATC 1 cut(s) 206
Bst4CI ACNGT 2 cut(s) 79, 168
BstC8I GCNNGC 1 cut(s) 217
BstKTI GATC 1 cut(s) 209
BstMBI GATC 1 cut(s) 206
BstNSI RCATGY 1 cut(s) 154
BstSFI CTRYAG 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 206
BstYI RGATCY 1 cut(s) 206
Cac8I GCNNGC 1 cut(s) 217
Cfr13I GGNCC 1 cut(s) 159
CviAII CATG 1 cut(s) 151
CviJI RGCY 5 cut(s) 19, 35, 85, 134, 215
CviKI_1 RGCY 5 cut(s) 19, 35, 85, 134, 215
DpnI GATC 1 cut(s) 208
DpnII GATC 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 159
Eco57I CTGAAG 1 cut(s) 68
EcoO109I RGGNCCY 1 cut(s) 159
FaeI CATG 1 cut(s) 154
FaiI YATR 4 cut(s) 56, 113, 152, 194
FaqI GGGAC 1 cut(s) 172
FatI CATG 1 cut(s) 150
Fnu4HI GCNGC 1 cut(s) 33
Fsp4HI GCNGC 1 cut(s) 33
FspBI CTAG 2 cut(s) 20, 95
GluI GCNGC 1 cut(s) 33
Hin1II CATG 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 2 cut(s) 12, 198
HpyAV CCTTC 3 cut(s) 98, 122, 145
HpyCH4III ACNGT 2 cut(s) 79, 168
HpyCH4V TGCA 2 cut(s) 154, 219
Hsp92II CATG 1 cut(s) 154
Kzo9I GATC 1 cut(s) 206
LmnI GCTCC 2 cut(s) 14, 131
LpnPI CCDG 3 cut(s) 25, 55, 140
MaeI CTAG 2 cut(s) 20, 95
MaeIII GTNAC 1 cut(s) 146
MalI GATC 1 cut(s) 208
MboI GATC 1 cut(s) 206
MboII GAAGA 2 cut(s) 61, 113
MflI RGATCY 1 cut(s) 206
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 2 cut(s) 25, 72
NdeII GATC 1 cut(s) 206
NlaIII CATG 1 cut(s) 154
NlaIV GGNNCC 2 cut(s) 133, 160
NmuCI GTSAC 1 cut(s) 146
NspI RCATGY 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 196
PkrI GCNGC 1 cut(s) 34
PpuMI RGGWCCY 1 cut(s) 159
Psp5II RGGWCCY 1 cut(s) 159
PspN4I GGNNCC 2 cut(s) 133, 160
PspPI GGNCC 1 cut(s) 159
PspPPI RGGWCCY 1 cut(s) 159
PsuI RGATCY 1 cut(s) 206
SatI GCNGC 1 cut(s) 33
Sau3AI GATC 1 cut(s) 206
Sau96I GGNCC 1 cut(s) 159
SduI GDGCHC 1 cut(s) 11
SetI ASST 3 cut(s) 87, 164, 217
SfcI CTRYAG 1 cut(s) 210
SgeI CNNG 9 cut(s) 24, 32, 54, 107, 163, 167, 201, 210, 215
SinI GGWCC 1 cut(s) 159
Sse9I AATT 2 cut(s) 25, 72
SsiI CCGC 1 cut(s) 32
SspMI CTAG 2 cut(s) 20, 95
TaaI ACNGT 2 cut(s) 79, 168
TaqI TCGA 1 cut(s) 199
TasI AATT 2 cut(s) 25, 72
TauI GCSGC 1 cut(s) 35
TseFI GTSAC 1 cut(s) 146
Tsp45I GTSAC 1 cut(s) 146
TspDTI ATGAA 2 cut(s) 77, 141
TspGWI ACGGA 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 159
XapI RAATTY 1 cut(s) 25
XceI RCATGY 1 cut(s) 154
XspI CTAG 2 cut(s) 20, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.