RchiOBHm_Chr3g0480011

Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
25840713 .. 25841172
460 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGACTATAATCCAACAAAGATCTCCTGTTGTTAAGGGGATGATGATTGAATTTGCTAAGAACTCAGTTGATTATGTTACTGCCAGCGCCCAGCGGAAAGAAGCATGTTATTGTGTTTTCAAGCTTAAACTTTCAGGGGTGGCAGAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.6

Weight (kDa)

9.39

Isoelectric Point (pI)

34.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 94
AcsI RAATTY 1 cut(s) 50
AgsI TTSAA 2 cut(s) 50, 121
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
ApoI RAATTY 1 cut(s) 50
AspLEI GCGC 1 cut(s) 89
BfoI RGCGCY 1 cut(s) 90
BglII AGATCT 1 cut(s) 20
BseGI GGATG 1 cut(s) 45
BseMII CTCAG 1 cut(s) 78
BseYI CCCAGC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 20
BspACI CCGC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 77
BssMI GATC 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 85
BstDEI CTNAG 2 cut(s) 57, 64
BstF5I GGATG 1 cut(s) 45
BstH2I RGCGCY 1 cut(s) 90
BstHHI GCGC 1 cut(s) 89
BstKTI GATC 1 cut(s) 23
BstMBI GATC 1 cut(s) 20
BstNSI RCATGY 1 cut(s) 108
BstX2I RGATCY 1 cut(s) 20
BstYI RGATCY 1 cut(s) 20
BtsCI GGATG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 85
CfoI GCGC 1 cut(s) 89
CviAII CATG 1 cut(s) 105
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DdeI CTNAG 2 cut(s) 57, 64
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
FaeI CATG 1 cut(s) 108
FaiI YATR 3 cut(s) 8, 75, 106
FatI CATG 1 cut(s) 104
FokI GGATG 1 cut(s) 52
GlaI GCGC 1 cut(s) 88
GsaI CCCAGC 1 cut(s) 94
HaeII RGCGCY 1 cut(s) 90
HhaI GCGC 1 cut(s) 89
Hin1II CATG 1 cut(s) 108
Hin6I GCGC 1 cut(s) 87
HinP1I GCGC 1 cut(s) 87
HindIII AAGCTT 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 57, 64
Hsp92II CATG 1 cut(s) 108
HspAI GCGC 1 cut(s) 87
Kzo9I GATC 1 cut(s) 20
LpnPI CCDG 4 cut(s) 39, 97, 104, 120
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MflI RGATCY 1 cut(s) 20
MluCI AATT 1 cut(s) 50
MmeI TCCRAC 1 cut(s) 37
MseI TTAA 2 cut(s) 33, 126
MspA1I CMGCKG 1 cut(s) 94
NdeII GATC 1 cut(s) 20
NlaIII CATG 1 cut(s) 108
NspI RCATGY 1 cut(s) 108
PspFI CCCAGC 1 cut(s) 90
PsuI RGATCY 1 cut(s) 20
SaqAI TTAA 2 cut(s) 33, 126
Sau3AI GATC 1 cut(s) 20
SetI ASST 1 cut(s) 126
SgeI CNNG 6 cut(s) 38, 96, 103, 117, 133, 147
Sse9I AATT 1 cut(s) 50
SsiI CCGC 1 cut(s) 94
TasI AATT 1 cut(s) 50
Tru1I TTAA 2 cut(s) 33, 126
Tru9I TTAA 2 cut(s) 33, 126
XapI RAATTY 1 cut(s) 50
XceI RCATGY 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.