RchiOBHm_Chr6g0278231

Encodes a close homolog of the Cauliflower OR (Orange) protein. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
41209464 .. 41210365
902 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24957

Sequence Viewer

Length: 168 bp
ATGATGGTTGAAATAATAAGCAAAACACTGCAGGAGCATCAGAGATGTAAATATTGTCTTGGAACTGCTTATGGCTCATCTTCTGATGCAATGACTATAATCCAACAAAGATCTCCTGTTGTTAAGAGCCCAGCGGAAAGAAGCATGTTATTGTGTTTTCAAGCTTAA

Protein Analysis

55

Amino Acids

6.17

Weight (kDa)

8.59

Isoelectric Point (pI)

69.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 134
AgsI TTSAA 2 cut(s) 11, 161
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
BanII GRGCYC 1 cut(s) 131
BfmI CTRYAG 1 cut(s) 29
BglII AGATCT 1 cut(s) 110
BmsI GCATC 2 cut(s) 46, 76
Bse3DI GCAATG 1 cut(s) 96
BseMI GCAATG 1 cut(s) 96
BseYI CCCAGC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 131
Bsp143I GATC 1 cut(s) 110
BspACI CCGC 1 cut(s) 134
BspMAI CTGCAG 1 cut(s) 33
BsrDI GCAATG 1 cut(s) 96
BssMI GATC 1 cut(s) 110
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 148
BstSFI CTRYAG 1 cut(s) 29
BstX2I RGATCY 1 cut(s) 110
BstYI RGATCY 1 cut(s) 110
BtsI GCAGTG 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 26
CviAII CATG 1 cut(s) 145
CviJI RGCY 3 cut(s) 75, 129, 164
CviKI_1 RGCY 3 cut(s) 75, 129, 164
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
Eco24I GRGCYC 1 cut(s) 131
EcoT38I GRGCYC 1 cut(s) 131
FaeI CATG 1 cut(s) 148
FaiI YATR 3 cut(s) 72, 98, 146
FatI CATG 1 cut(s) 144
FriOI GRGCYC 1 cut(s) 131
FspEI CC 8 cut(s) 17, 45, 57, 116, 119, 129, 143, 144
GsaI CCCAGC 1 cut(s) 134
Hin1II CATG 1 cut(s) 148
HindIII AAGCTT 1 cut(s) 162
Hpy188I TCNGA 2 cut(s) 42, 85
HpyCH4V TGCA 2 cut(s) 31, 89
Hsp92II CATG 1 cut(s) 148
Kzo9I GATC 1 cut(s) 110
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 3 cut(s) 17, 129, 144
LweI GCATC 2 cut(s) 46, 76
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MboII GAAGA 1 cut(s) 72
MflI RGATCY 1 cut(s) 110
MhlI GDGCHC 1 cut(s) 131
MmeI TCCRAC 1 cut(s) 127
MseI TTAA 2 cut(s) 123, 166
MspA1I CMGCKG 1 cut(s) 134
NdeII GATC 1 cut(s) 110
NlaIII CATG 1 cut(s) 148
NspI RCATGY 1 cut(s) 148
PspFI CCCAGC 1 cut(s) 130
PstI CTGCAG 1 cut(s) 33
PsuI RGATCY 1 cut(s) 110
SaqAI TTAA 2 cut(s) 123, 166
Sau3AI GATC 1 cut(s) 110
SduI GDGCHC 1 cut(s) 131
SetI ASST 1 cut(s) 166
SfaNI GCATC 2 cut(s) 46, 76
SfcI CTRYAG 1 cut(s) 29
SgeI CNNG 5 cut(s) 44, 71, 128, 143, 157
SsiI CCGC 1 cut(s) 134
SspI AATATT 1 cut(s) 53
Tru1I TTAA 2 cut(s) 123, 166
Tru9I TTAA 2 cut(s) 123, 166
TscAI CASTG 1 cut(s) 33
TspRI CASTG 1 cut(s) 33
XceI RCATGY 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.