Rroxscaffold_1G00001830

Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG1

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
2047682 .. 2057785
10104 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00001830.1

Sequence Viewer

Length: 243 bp
ATGATGGTTGAAATAATAAGCAAAACACTGCAGGAGCATCAGAGATGTAAATATTGTCTTGGAACTGCTTATGGCTCATCTTCTGATGCAATGACTATAATCCAACAAAGATCTTCTGTTGTTAAGGGGATGATGATTGAATTTGCTAAGAACTCAGTTGATTATGTTACTGCCAGCGCCCAGCGGAAAGAAGCATGTTATTTTGTTTTCAAGCTTAAACTTACGGGGGTGGCAGAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.97

Weight (kDa)

8.86

Isoelectric Point (pI)

32.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 184
AcsI RAATTY 1 cut(s) 140
AgsI TTSAA 3 cut(s) 11, 140, 211
AluBI AGCT 1 cut(s) 214
AluI AGCT 1 cut(s) 214
ApoI RAATTY 1 cut(s) 140
AspLEI GCGC 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 29
BfoI RGCGCY 1 cut(s) 180
BglII AGATCT 1 cut(s) 110
BmsI GCATC 2 cut(s) 46, 76
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 135
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 168
BseYI CCCAGC 1 cut(s) 180
Bsp143I GATC 1 cut(s) 110
BspACI CCGC 1 cut(s) 184
BspCNI CTCAG 1 cut(s) 167
BspMAI CTGCAG 1 cut(s) 33
BsrDI GCAATG 1 cut(s) 96
BssMI GATC 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 175
BstDEI CTNAG 2 cut(s) 147, 154
BstF5I GGATG 1 cut(s) 135
BstH2I RGCGCY 1 cut(s) 180
BstHHI GCGC 1 cut(s) 179
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 198
BstSFI CTRYAG 1 cut(s) 29
BstX2I RGATCY 1 cut(s) 110
BstYI RGATCY 1 cut(s) 110
BtsCI GGATG 1 cut(s) 135
BtsI GCAGTG 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 26
Cac8I GCNNGC 1 cut(s) 175
CfoI GCGC 1 cut(s) 179
CviAII CATG 1 cut(s) 195
CviJI RGCY 2 cut(s) 75, 214
CviKI_1 RGCY 2 cut(s) 75, 214
DdeI CTNAG 2 cut(s) 147, 154
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
FaeI CATG 1 cut(s) 198
FaiI YATR 4 cut(s) 72, 98, 165, 196
FatI CATG 1 cut(s) 194
FokI GGATG 1 cut(s) 142
GlaI GCGC 1 cut(s) 178
GsaI CCCAGC 1 cut(s) 184
HaeII RGCGCY 1 cut(s) 180
HhaI GCGC 1 cut(s) 179
Hin1II CATG 1 cut(s) 198
Hin6I GCGC 1 cut(s) 177
HinP1I GCGC 1 cut(s) 177
HindIII AAGCTT 1 cut(s) 212
Hpy188I TCNGA 2 cut(s) 42, 85
HpyCH4V TGCA 2 cut(s) 31, 89
HpyF3I CTNAG 2 cut(s) 147, 154
Hsp92II CATG 1 cut(s) 198
HspAI GCGC 1 cut(s) 177
Kzo9I GATC 1 cut(s) 110
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 3 cut(s) 17, 187, 194
LweI GCATC 2 cut(s) 46, 76
MaeIII GTNAC 1 cut(s) 166
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MboII GAAGA 2 cut(s) 72, 105
MflI RGATCY 1 cut(s) 110
MluCI AATT 2 cut(s) 140, 238
MmeI TCCRAC 1 cut(s) 127
MseI TTAA 3 cut(s) 123, 216, 241
MspA1I CMGCKG 1 cut(s) 184
NdeII GATC 1 cut(s) 110
NlaIII CATG 1 cut(s) 198
NspI RCATGY 1 cut(s) 198
PspFI CCCAGC 1 cut(s) 180
PstI CTGCAG 1 cut(s) 33
PsuI RGATCY 1 cut(s) 110
SaqAI TTAA 3 cut(s) 123, 216, 241
Sau3AI GATC 1 cut(s) 110
SetI ASST 1 cut(s) 216
SfaNI GCATC 2 cut(s) 46, 76
SfcI CTRYAG 1 cut(s) 29
SgeI CNNG 7 cut(s) 44, 71, 186, 193, 207, 223, 237
Sse9I AATT 2 cut(s) 140, 238
SsiI CCGC 1 cut(s) 184
SspI AATATT 1 cut(s) 53
TasI AATT 2 cut(s) 140, 238
Tru1I TTAA 3 cut(s) 123, 216, 241
Tru9I TTAA 3 cut(s) 123, 216, 241
TscAI CASTG 1 cut(s) 33
TspRI CASTG 1 cut(s) 33
XapI RAATTY 1 cut(s) 140
XceI RCATGY 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.