RchiOBHm_Chr2g0122341

Encodes a close homolog of the Cauliflower OR (Orange) protein. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
35326903 .. 35332912
6010 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49475

Sequence Viewer

Length: 174 bp
ATGTTGTTGGTTGGACCTATTGTTGGACTTGATCAATATGTCAACTACTTCAAAATTCAGCTGAGGATACAACAGAGGATTAAAAGCGCAGAGCTCAGGATGTTAACCGAGGAGCAAGAAAATGAACTTCCAAACTTTACACCATTCATTCAATTGATGTCTCCCTTGTTGTAG

Protein Analysis

57

Amino Acids

6.72

Weight (kDa)

5.11

Isoelectric Point (pI)

43.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 23
AgsI TTSAA 2 cut(s) 52, 152
AluBI AGCT 2 cut(s) 61, 94
AluI AGCT 2 cut(s) 61, 94
Alw21I GWGCWC 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 165
ApoI RAATTY 1 cut(s) 54
AspLEI GCGC 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 14
AvaII GGWCC 1 cut(s) 14
BanII GRGCYC 1 cut(s) 96
Bbv12I GWGCWC 1 cut(s) 96
BbvCI CCTCAGC 1 cut(s) 62
BciVI GTATCC 1 cut(s) 60
BclI TGATCA 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 165
BfuI GTATCC 1 cut(s) 60
Bme18I GGWCC 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 14
Bpu10I CCTNAGC 2 cut(s) 62, 95
BsaJI CCNNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 23
BseMII CTCAG 2 cut(s) 53, 109
BseRI GAGGAG 1 cut(s) 125
BsiHKAI GWGCWC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 23
BsmAI GTCTC 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 31
BspCNI CTCAG 2 cut(s) 54, 108
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 62, 95
BstF5I GGATG 1 cut(s) 105
BstHHI GCGC 1 cut(s) 89
BstKTI GATC 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 165
BstMBI GATC 1 cut(s) 31
BsuI GTATCC 1 cut(s) 60
BtsCI GGATG 1 cut(s) 105
CfoI GCGC 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 14
CviJI RGCY 2 cut(s) 61, 94
CviKI_1 RGCY 2 cut(s) 61, 94
DdeI CTNAG 2 cut(s) 62, 95
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Ecl136II GAGCTC 1 cut(s) 94
Eco24I GRGCYC 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 14
Eco53kI GAGCTC 1 cut(s) 94
EcoICRI GAGCTC 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 96
FaiI YATR 1 cut(s) 39
FbaI TGATCA 1 cut(s) 31
FokI GGATG 1 cut(s) 112
FriOI GRGCYC 1 cut(s) 96
FspEI CC 9 cut(s) 9, 30, 49, 61, 82, 95, 121, 144, 156
GlaI GCGC 1 cut(s) 88
HhaI GCGC 1 cut(s) 89
Hin6I GCGC 1 cut(s) 87
HinP1I GCGC 1 cut(s) 87
HincII GTYRAC 2 cut(s) 43, 105
HindII GTYRAC 2 cut(s) 43, 105
HpaI GTTAAC 1 cut(s) 105
Hpy166II GTNNAC 2 cut(s) 43, 105
Hpy188III TCNNGA 1 cut(s) 97
Hpy8I GTNNAC 2 cut(s) 43, 105
HpyF3I CTNAG 2 cut(s) 62, 95
HspAI GCGC 1 cut(s) 87
Ksp22I TGATCA 1 cut(s) 31
KspAI GTTAAC 1 cut(s) 105
Kzo9I GATC 1 cut(s) 31
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 1 cut(s) 82
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MfeI CAATTG 1 cut(s) 152
MhlI GDGCHC 1 cut(s) 96
MluCI AATT 2 cut(s) 54, 152
MmeI TCCRAC 1 cut(s) 4
MnlI CCTC 3 cut(s) 57, 69, 103
MseI TTAA 2 cut(s) 81, 104
MspA1I CMGCKG 1 cut(s) 61
MunI CAATTG 1 cut(s) 152
NdeII GATC 1 cut(s) 31
Psp124BI GAGCTC 1 cut(s) 96
PspPI GGNCC 1 cut(s) 14
PvuII CAGCTG 1 cut(s) 61
SacI GAGCTC 1 cut(s) 96
SaqAI TTAA 2 cut(s) 81, 104
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 1 cut(s) 14
SduI GDGCHC 1 cut(s) 96
SetI ASST 3 cut(s) 19, 63, 96
SgeI CNNG 4 cut(s) 41, 109, 121, 128
SinI GGWCC 1 cut(s) 14
Sse9I AATT 2 cut(s) 54, 152
SstI GAGCTC 1 cut(s) 96
TasI AATT 2 cut(s) 54, 152
Tru1I TTAA 2 cut(s) 81, 104
Tru9I TTAA 2 cut(s) 81, 104
TspDTI ATGAA 2 cut(s) 136, 138
VpaK11BI GGWCC 1 cut(s) 14
XapI RAATTY 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.