Rh6DG222900

Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
39841162 .. 39841864
703 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG222900.1

Sequence Viewer

Length: 243 bp
ATGATGGTTGAAATAATAAGCAAAACACTGCAGGAGCATCAGAGATGTAAATATTGTCTTGGAACTGCTTATGGCTCATCTTCTGATGCAATGACTATAATCCAACAAAGATCTCCTGTTGTTAAGGGGATGATGATTGAATTTGCTAAGAACTCGGTTGATTGTGTTACTGCCAGAGCCCAGCGGAAAGAAGCATGTTATTGTGTTTTCAAGCTTAAACCTTCAGGGGTGGCAGAGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.91

Weight (kDa)

8.91

Isoelectric Point (pI)

39.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 184
AcsI RAATTY 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 207
AgsI TTSAA 3 cut(s) 11, 140, 211
AluBI AGCT 1 cut(s) 214
AluI AGCT 1 cut(s) 214
ApoI RAATTY 1 cut(s) 140
BanII GRGCYC 1 cut(s) 181
BfmI CTRYAG 1 cut(s) 29
BglII AGATCT 1 cut(s) 110
BmsI GCATC 2 cut(s) 46, 76
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 135
BseMI GCAATG 1 cut(s) 96
BseYI CCCAGC 1 cut(s) 180
Bsp1286I GDGCHC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 110
BspACI CCGC 1 cut(s) 184
BspMAI CTGCAG 1 cut(s) 33
BsrDI GCAATG 1 cut(s) 96
BssMI GATC 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 135
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 198
BstSFI CTRYAG 1 cut(s) 29
BstX2I RGATCY 1 cut(s) 110
BstYI RGATCY 1 cut(s) 110
BtsCI GGATG 1 cut(s) 135
BtsI GCAGTG 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 26
CviAII CATG 1 cut(s) 195
CviJI RGCY 3 cut(s) 75, 179, 214
CviKI_1 RGCY 3 cut(s) 75, 179, 214
DdeI CTNAG 1 cut(s) 147
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
Eco24I GRGCYC 1 cut(s) 181
Eco57I CTGAAG 1 cut(s) 207
EcoT38I GRGCYC 1 cut(s) 181
FaeI CATG 1 cut(s) 198
FaiI YATR 3 cut(s) 72, 98, 196
FatI CATG 1 cut(s) 194
FokI GGATG 1 cut(s) 142
FriOI GRGCYC 1 cut(s) 181
GsaI CCCAGC 1 cut(s) 184
Hin1II CATG 1 cut(s) 198
HindIII AAGCTT 1 cut(s) 212
Hpy188I TCNGA 2 cut(s) 42, 85
HpyAV CCTTC 1 cut(s) 231
HpyCH4V TGCA 2 cut(s) 31, 89
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 1 cut(s) 198
Kzo9I GATC 1 cut(s) 110
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 5 cut(s) 17, 129, 187, 194, 210
LweI GCATC 2 cut(s) 46, 76
MaeIII GTNAC 1 cut(s) 166
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MboII GAAGA 1 cut(s) 72
MflI RGATCY 1 cut(s) 110
MhlI GDGCHC 1 cut(s) 181
MluCI AATT 2 cut(s) 140, 238
MmeI TCCRAC 1 cut(s) 127
MseI TTAA 3 cut(s) 123, 216, 241
MspA1I CMGCKG 1 cut(s) 184
NdeII GATC 1 cut(s) 110
NlaIII CATG 1 cut(s) 198
NspI RCATGY 1 cut(s) 198
PspFI CCCAGC 1 cut(s) 180
PstI CTGCAG 1 cut(s) 33
PsuI RGATCY 1 cut(s) 110
SaqAI TTAA 3 cut(s) 123, 216, 241
Sau3AI GATC 1 cut(s) 110
SduI GDGCHC 1 cut(s) 181
SetI ASST 2 cut(s) 216, 223
SfaNI GCATC 2 cut(s) 46, 76
SfcI CTRYAG 1 cut(s) 29
SgeI CNNG 9 cut(s) 44, 71, 128, 166, 186, 193, 207, 223, 237
Sse9I AATT 2 cut(s) 140, 238
SsiI CCGC 1 cut(s) 184
SspI AATATT 1 cut(s) 53
TasI AATT 2 cut(s) 140, 238
Tru1I TTAA 3 cut(s) 123, 216, 241
Tru9I TTAA 3 cut(s) 123, 216, 241
TscAI CASTG 1 cut(s) 33
TspRI CASTG 1 cut(s) 33
XapI RAATTY 1 cut(s) 140
XceI RCATGY 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.