RchiOBHm_Chr2g0141441

GDP-mannose transporter

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
59000045 .. 59002622
2578 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGTCGTCTGATTTCAAGTTAGAGGGAGTTAAAGGCCATGAAATTAAGGACCCAGAAGTTTGTTCTCCAAATGGAATACATAATATTCTTGCAGAGCGAAGAACTATGACTCTCAGTGACAGATTATCCCTGCTATCAGCAGTGGCATTACAGATATCTCCTTTGACACTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.23

Weight (kDa)

6.02

Isoelectric Point (pI)

61.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 16
AoxI GGCC 1 cut(s) 34
AspS9I GGNCC 1 cut(s) 49
AvaII GGWCC 1 cut(s) 49
BfmI CTRYAG 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 49
BmiI GGNNCC 1 cut(s) 51
BseMII CTCAG 1 cut(s) 127
BshFI GGCC 1 cut(s) 36
BsnI GGCC 1 cut(s) 36
BspANI GGCC 1 cut(s) 36
BspCNI CTCAG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 113
BstSFI CTRYAG 1 cut(s) 170
BsuRI GGCC 1 cut(s) 36
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 3 cut(s) 121, 147, 167
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 1 cut(s) 38
CviJI RGCY 1 cut(s) 36
CviKI_1 RGCY 1 cut(s) 36
DdeI CTNAG 1 cut(s) 113
Eco32I GATATC 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 49
EcoO109I RGGNCCY 1 cut(s) 49
EcoRV GATATC 1 cut(s) 156
FaeI CATG 1 cut(s) 41
FaiI YATR 3 cut(s) 39, 81, 107
FatI CATG 1 cut(s) 37
HaeIII GGCC 1 cut(s) 36
Hin1II CATG 1 cut(s) 41
HinfI GANTC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 10
HpyCH4III ACNGT 1 cut(s) 171
HpyCH4V TGCA 1 cut(s) 92
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 41
LpnPI CCDG 2 cut(s) 66, 143
MaeIII GTNAC 1 cut(s) 116
MboII GAAGA 1 cut(s) 111
MluCI AATT 1 cut(s) 42
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 1 cut(s) 16
MseI TTAA 2 cut(s) 30, 45
NlaIII CATG 1 cut(s) 41
NlaIV GGNNCC 1 cut(s) 51
NmuCI GTSAC 1 cut(s) 116
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
PpuMI RGGWCCY 1 cut(s) 49
Psp5II RGGWCCY 1 cut(s) 49
PspN4I GGNNCC 1 cut(s) 51
PspPI GGNCC 1 cut(s) 49
PspPPI RGGWCCY 1 cut(s) 49
SaqAI TTAA 2 cut(s) 30, 45
Sau96I GGNCC 1 cut(s) 49
SchI GAGTC 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 170
SgeI CNNG 5 cut(s) 28, 50, 65, 101, 142
SinI GGWCC 1 cut(s) 49
Sse9I AATT 1 cut(s) 42
SspI AATATT 1 cut(s) 85
TaaI ACNGT 1 cut(s) 171
TasI AATT 1 cut(s) 42
Tru1I TTAA 2 cut(s) 30, 45
Tru9I TTAA 2 cut(s) 30, 45
TscAI CASTG 3 cut(s) 121, 147, 174
TseFI GTSAC 1 cut(s) 116
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 54
TspRI CASTG 3 cut(s) 121, 147, 174
VpaK11BI GGWCC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.