RchiOBHm_Chr2g0176091

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
88035209 .. 88036366
1158 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 714 bp
ATGTCTATGTTTCTAGTGAAAGGGATAAAATTTCCCCAACTTTTTGCATACAGTTGTATCTCCATCATCTCTATTTCCCTCATTATCCACACAAAAAGAAAGACTACTCATCTTCAACAATGTGATAATGCTCTCAGAGCTGAAATCCATACCAGAAGCCTAGCTAGGCAGTTCATCTCCATTAATTTTGCCATGAATCCAGTAATTCTCTTTCTTATTTCCTCTATGTTTTTTCAGTCAGCTATTCTGGGAGGTGAATCAGCAAGGGCAGTAAAAGGTAACTCCCAGATTATTGTAATGGGCCTTGTTTACTGTGACATCTGCTCCAACAACACCTTCTCCCCTCACAGCTACTTCATTCCAGGTGCTGAGGTTAAAATAGATTGCGTATTCAAAGCAGTGTCACCAAGAATTGCAGAACACATATCATTCTCAGCGAATAGAACTACAAACAGGTATGGGGTGTACAAGTTGGAAATCCCATCAGTTGAGGGAATCAAATGTGCAGAAGATTCTGCGATAGTTTCTTCCTGCCAGGCAAGCTTAATGCGGAGTGGATCTCCAGCTTGTAATGTTCCTGGTTTCAAATCCACAGCAGATGAAATAGCAGTCAAATCAAAGGAAGCTAATCTCTGCATCTACAGCCTCAATGCTTTGAATTTCAGACCATCAAGGAGAGACATTGCCTTATGTGGCAAGAAAAAAATTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

237

Amino Acids

26.07

Weight (kDa)

9.37

Isoelectric Point (pI)

42.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 99 - 196 2.6e-19 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015014)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26960 AT5G41050
fragaria_vesca FvH4_6g53930
malus_domestica MD17G1011000.v1.1
prunus_persica Prupe.3G309900_v2.0.a1
pyrus_communis pycom17g00570
rosa_chinensis RchiOBHm_Chr2g0176091
rosa_laevigata RLG00000022380
rosa_multiflora Rmu_sc0009879.1_g000002
rosa_roxburghii Rroxscaffold_2G00076780
rosa_rugosa Rorug02G0590400
rosa_samantha Rh2AG669200 Rh2BG680800 Rh2CG643700 Rh2DG694500
rosa_wichuraiana Rw2G054890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 550
AclWI GGATC 1 cut(s) 565
AcsI RAATTY 2 cut(s) 29, 658
AfaI GTAC 1 cut(s) 467
AgsI TTSAA 4 cut(s) 116, 394, 586, 658
AjnI CCWGG 3 cut(s) 361, 534, 577
AjuI GAANNNNNNNTTGG 2 cut(s) 320, 352
AluBI AGCT 7 cut(s) 140, 164, 242, 351, 543, 566, 626
AluI AGCT 7 cut(s) 140, 164, 242, 351, 543, 566, 626
Alw26I GTCTC 1 cut(s) 672
AlwI GGATC 1 cut(s) 565
AlwNI CAGNNNCTG 1 cut(s) 368
AoxI GGCC 1 cut(s) 301
ApoI RAATTY 2 cut(s) 29, 658
AseI ATTAAT 2 cut(s) 183, 708
AspS9I GGNCC 1 cut(s) 301
AsuHPI GGTGA 2 cut(s) 266, 396
BaeI ACNNNNGTAYC 2 cut(s) 40, 73
BbvCI CCTCAGC 1 cut(s) 369
BccI CCATC 3 cut(s) 71, 490, 676
BciT130I CCWGG 3 cut(s) 363, 536, 579
BcoDI GTCTC 1 cut(s) 672
BfaI CTAG 3 cut(s) 14, 161, 165
BfmI CTRYAG 1 cut(s) 640
Bme1390I CCNGG 3 cut(s) 363, 536, 579
BmgT120I GGNCC 1 cut(s) 301
BmrFI CCNGG 3 cut(s) 363, 536, 579
BmsI GCATC 1 cut(s) 645
BplI GAGNNNNNCTC 2 cut(s) 544, 576
BpmI CTGGAG 1 cut(s) 546
Bpu10I CCTNAGC 1 cut(s) 369
BsaXI ACNNNNNCTCC 4 cut(s) 308, 323, 338, 353
Bse1I ACTGG 1 cut(s) 200
Bse3DI GCAATG 1 cut(s) 681
BseBI CCWGG 3 cut(s) 363, 536, 579
BseMI GCAATG 1 cut(s) 681
BseMII CTCAG 3 cut(s) 148, 360, 447
BseNI ACTGG 1 cut(s) 200
BsgI GTGCAG 1 cut(s) 525
BshFI GGCC 1 cut(s) 303
BsmAI GTCTC 1 cut(s) 672
BsnI GGCC 1 cut(s) 303
Bsp1407I TGTACA 1 cut(s) 465
Bsp143I GATC 1 cut(s) 557
BspACI CCGC 1 cut(s) 550
BspANI GGCC 1 cut(s) 303
BspCNI CTCAG 3 cut(s) 147, 361, 446
BspPI GGATC 1 cut(s) 565
BsrDI GCAATG 1 cut(s) 681
BsrGI TGTACA 1 cut(s) 465
BsrI ACTGG 1 cut(s) 200
BssMI GATC 1 cut(s) 557
Bst2UI CCWGG 3 cut(s) 363, 536, 579
Bst4CI ACNGT 2 cut(s) 53, 314
BstAUI TGTACA 1 cut(s) 465
BstC8I GCNNGC 1 cut(s) 541
BstDEI CTNAG 3 cut(s) 134, 369, 433
BstKTI GATC 1 cut(s) 560
BstMAI GTCTC 1 cut(s) 672
BstMBI GATC 1 cut(s) 557
BstMWI GCNNNNNNNGC 3 cut(s) 137, 540, 642
BstNI CCWGG 3 cut(s) 363, 536, 579
BstSCI CCNGG 3 cut(s) 361, 534, 577
BstSFI CTRYAG 1 cut(s) 640
BstX2I RGATCY 1 cut(s) 557
BstYI RGATCY 1 cut(s) 557
BsuRI GGCC 1 cut(s) 303
BtsI GCAGTG 1 cut(s) 405
BtsIMutI CAGTG 1 cut(s) 405
Cac8I GCNNGC 1 cut(s) 541
CaiI CAGNNNCTG 1 cut(s) 368
Cfr13I GGNCC 1 cut(s) 301
Csp6I GTAC 1 cut(s) 466
CviAII CATG 1 cut(s) 193
CviQI GTAC 1 cut(s) 466
DdeI CTNAG 3 cut(s) 134, 369, 433
DpnI GATC 1 cut(s) 559
DpnII GATC 1 cut(s) 557
EcoRII CCWGG 3 cut(s) 361, 534, 577
FaeI CATG 1 cut(s) 196
FaiI YATR 8 cut(s) 8, 49, 150, 194, 227, 425, 459, 691
FatI CATG 1 cut(s) 192
FspBI CTAG 3 cut(s) 14, 161, 165
GsuI CTGGAG 1 cut(s) 546
HaeIII GGCC 1 cut(s) 303
Hin1II CATG 1 cut(s) 196
HindIII AAGCTT 1 cut(s) 541
HinfI GANTC 4 cut(s) 196, 257, 495, 512
HphI GGTGA 2 cut(s) 266, 396
Hpy166II GTNNAC 2 cut(s) 310, 466
Hpy188I TCNGA 2 cut(s) 137, 665
Hpy8I GTNNAC 2 cut(s) 310, 466
HpyAV CCTTC 1 cut(s) 346
HpyCH4III ACNGT 2 cut(s) 53, 314
HpyCH4V TGCA 4 cut(s) 47, 416, 506, 636
HpyF10VI GCNNNNNNNGC 3 cut(s) 137, 540, 642
HpyF3I CTNAG 3 cut(s) 134, 369, 433
Hsp92II CATG 1 cut(s) 196
Kzo9I GATC 1 cut(s) 557
LmnI GCTCC 1 cut(s) 329
LweI GCATC 1 cut(s) 645
MaeI CTAG 3 cut(s) 14, 161, 165
MaeIII GTNAC 3 cut(s) 278, 314, 402
MalI GATC 1 cut(s) 559
MboI GATC 1 cut(s) 557
MboII GAAGA 3 cut(s) 104, 519, 521
MflI RGATCY 1 cut(s) 557
MluCI AATT 7 cut(s) 29, 184, 204, 411, 658, 705, 709
MmeI TCCRAC 2 cut(s) 351, 453
MnlI CCTC 7 cut(s) 89, 232, 245, 354, 364, 484, 656
MseI TTAA 4 cut(s) 183, 375, 545, 708
MspR9I CCNGG 3 cut(s) 363, 536, 579
MvaI CCWGG 3 cut(s) 363, 536, 579
MwoI GCNNNNNNNGC 3 cut(s) 137, 540, 642
NdeII GATC 1 cut(s) 557
NlaIII CATG 1 cut(s) 196
NmuCI GTSAC 2 cut(s) 314, 402
PfeI GAWTC 4 cut(s) 196, 257, 495, 512
PshBI ATTAAT 2 cut(s) 183, 708
Psp6I CCWGG 3 cut(s) 361, 534, 577
PspGI CCWGG 3 cut(s) 361, 534, 577
PspPI GGNCC 1 cut(s) 301
PstNI CAGNNNCTG 1 cut(s) 368
PsuI RGATCY 1 cut(s) 557
RsaI GTAC 1 cut(s) 467
RsaNI GTAC 1 cut(s) 466
SaqAI TTAA 4 cut(s) 183, 375, 545, 708
Sau3AI GATC 1 cut(s) 557
Sau96I GGNCC 1 cut(s) 301
ScrFI CCNGG 3 cut(s) 363, 536, 579
SfaNI GCATC 1 cut(s) 645
SfcI CTRYAG 1 cut(s) 640
Sse9I AATT 7 cut(s) 29, 184, 204, 411, 658, 705, 709
SsiI CCGC 1 cut(s) 550
SspMI CTAG 3 cut(s) 14, 161, 165
StyD4I CCNGG 3 cut(s) 361, 534, 577
TaaI ACNGT 2 cut(s) 53, 314
TasI AATT 7 cut(s) 29, 184, 204, 411, 658, 705, 709
TatI WGTACW 1 cut(s) 465
TfiI GAWTC 4 cut(s) 196, 257, 495, 512
Tru1I TTAA 4 cut(s) 183, 375, 545, 708
Tru9I TTAA 4 cut(s) 183, 375, 545, 708
TscAI CASTG 1 cut(s) 405
TseFI GTSAC 2 cut(s) 314, 402
Tsp45I GTSAC 2 cut(s) 314, 402
TspDTI ATGAA 4 cut(s) 163, 209, 346, 615
TspRI CASTG 1 cut(s) 405
VspI ATTAAT 2 cut(s) 183, 708
XapI RAATTY 2 cut(s) 29, 658
XspI CTAG 3 cut(s) 14, 161, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.