RchiOBHm_Chr1g0328771

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
18164713 .. 18165165
453 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGTTTTGTACCATTCTTTTGGACATCGCTAAAGTTAGGCTCCAGCTCCAAAAGAAAGCAGTTGTAGGGGATGCAGCTGATGCACCTAAATATAGGGGCTTGTTGGGTACTATGGCTACCATTGCTAGGGAAGAAGGTTTAGCAGCTCCTTGGAATAGTATAATTCCAGGATTACAGCGACAATGCATCTATGGAGGCTTAAGAATTAGGTTATATGATCCTGTGATTTTTTAA

Protein Analysis

77

Amino Acids

8.5

Weight (kDa)

9.44

Isoelectric Point (pI)

43.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mito_carr PF00153 3 - 73 3e-08 Mitochondrial carrier protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 212
AfaI GTAC 2 cut(s) 10, 109
AfiI CCNNNNNNNGG 1 cut(s) 126
AflII CTTAAG 1 cut(s) 199
AjnI CCWGG 1 cut(s) 166
AluBI AGCT 3 cut(s) 46, 77, 146
AluI AGCT 3 cut(s) 46, 77, 146
AlwI GGATC 1 cut(s) 212
ApeKI GCWGC 2 cut(s) 74, 143
BbvI GCAGC 2 cut(s) 86, 155
BciT130I CCWGG 1 cut(s) 168
BfaI CTAG 1 cut(s) 126
BfrI CTTAAG 1 cut(s) 199
BisI GCNGC 2 cut(s) 75, 144
BlsI GCNGC 2 cut(s) 76, 145
Bme1390I CCNGG 1 cut(s) 168
BmiI GGNNCC 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 3 cut(s) 61, 70, 195
BpmI CTGGAG 1 cut(s) 26
BsaJI CCNNGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 126
Bse3DI GCAATG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 149
BseGI GGATG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMI GCAATG 1 cut(s) 120
BseXI GCAGC 2 cut(s) 86, 155
BslI CCNNNNNNNGG 1 cut(s) 126
Bsp143I GATC 1 cut(s) 217
BspLI GGNNCC 1 cut(s) 41
BspPI GGATC 1 cut(s) 212
BspTI CTTAAG 1 cut(s) 199
BsrDI GCAATG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 1 cut(s) 217
BssT1I CCWWGG 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 168
BstAFI CTTAAG 1 cut(s) 199
BstAPI GCANNNNNTGC 1 cut(s) 80
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstMWI GCNNNNNNNGC 2 cut(s) 80, 122
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstV1I GCAGC 2 cut(s) 86, 155
BstXI CCANNNNNNTGG 1 cut(s) 19
BtgZI GCGATG 1 cut(s) 10
BtsCI GGATG 1 cut(s) 76
Csp6I GTAC 2 cut(s) 9, 108
CviJI RGCY 7 cut(s) 40, 46, 77, 99, 116, 146, 198
CviKI_1 RGCY 7 cut(s) 40, 46, 77, 99, 116, 146, 198
CviQI GTAC 2 cut(s) 9, 108
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 149
EcoT22I ATGCAT 1 cut(s) 188
ErhI CCWWGG 1 cut(s) 149
FaiI YATR 6 cut(s) 93, 113, 161, 192, 214, 216
Fnu4HI GCNGC 2 cut(s) 75, 144
FokI GGATG 1 cut(s) 83
Fsp4HI GCNGC 2 cut(s) 75, 144
FspBI CTAG 1 cut(s) 126
GluI GCNGC 2 cut(s) 75, 144
GsuI CTGGAG 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 3 cut(s) 74, 83, 186
HpyF10VI GCNNNNNNNGC 2 cut(s) 80, 122
Kzo9I GATC 1 cut(s) 217
LmnI GCTCC 3 cut(s) 45, 51, 151
LpnPI CCDG 3 cut(s) 56, 153, 180
Lsp1109I GCAGC 2 cut(s) 86, 155
LweI GCATC 3 cut(s) 61, 70, 195
MaeI CTAG 1 cut(s) 126
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 1 cut(s) 143
MluCI AATT 2 cut(s) 162, 204
MnlI CCTC 1 cut(s) 188
Mph1103I ATGCAT 1 cut(s) 188
MseI TTAA 2 cut(s) 200, 232
MspA1I CMGCKG 1 cut(s) 77
MspCI CTTAAG 1 cut(s) 199
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
MwoI GCNNNNNNNGC 2 cut(s) 80, 122
NdeII GATC 1 cut(s) 217
NlaIV GGNNCC 1 cut(s) 41
NsiI ATGCAT 1 cut(s) 188
PfoI TCCNGGA 1 cut(s) 166
PkrI GCNGC 2 cut(s) 76, 145
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 41
PvuII CAGCTG 1 cut(s) 77
RsaI GTAC 2 cut(s) 10, 109
RsaNI GTAC 2 cut(s) 9, 108
SaqAI TTAA 2 cut(s) 200, 232
SatI GCNGC 2 cut(s) 75, 144
Sau3AI GATC 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 168
SetI ASST 6 cut(s) 48, 79, 88, 139, 148, 212
SfaNI GCATC 3 cut(s) 61, 70, 195
SgeI CNNG 6 cut(s) 55, 112, 138, 162, 179, 180
SmlI CTYRAG 1 cut(s) 199
SmoI CTYRAG 1 cut(s) 199
Sse9I AATT 2 cut(s) 162, 204
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 166
StyI CCWWGG 1 cut(s) 149
TasI AATT 2 cut(s) 162, 204
Tru1I TTAA 2 cut(s) 200, 232
Tru9I TTAA 2 cut(s) 200, 232
TseI GCWGC 2 cut(s) 74, 143
Vha464I CTTAAG 1 cut(s) 199
XspI CTAG 1 cut(s) 126
Zsp2I ATGCAT 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.