Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0004603

Physical Location & Seq

Genomic Coordinates Reverse (-)

18164713 .. 18165165

Gene Structure 453 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ55814

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGTTTTGTACCATTCTTTTGGACATCGCTAAAGTTAGGCTCCAGCTCCAAAAGAAAGCAGTTGTAGGGGATGCAGCTGATGCACCTAAATATAGGGGCTTGTTGGGTACTATGGCTACCATTGCTAGGGAAGAAGGTTTAGCAGCTCCTTGGAATAGTATAATTCCAGGATTACAGCGACAATGCATCTATGGAGGCTTAAGAATTAGGTTATATGATCCTGTGATTTTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003333 GO:0003674 GO:0005215 GO:0005342 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005740 GO:0005743 GO:0005794 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006820 GO:0006839 GO:0006865 GO:0006950 GO:0008150 GO:0008152 GO:0008509 GO:0008514 GO:0009266 GO:0009409 GO:0009628 GO:0012505 GO:0015075 GO:0015171 GO:0015318 GO:0015672 GO:0015711 GO:0015849 GO:0016020 GO:0016021 GO:0017077 GO:0019866 GO:0022857 GO:0031090 GO:0031224 GO:0031966 GO:0031967 GO:0031975 GO:0034220 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044429 GO:0044444 GO:0044446 GO:0044464 GO:0046942 GO:0046943 GO:0050896 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0071944 GO:0098655 GO:0098656 GO:0098660 GO:0098662 GO:1902600 GO:1903825 GO:1905039 GO:1990542 GO:1990845

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mito_carr

Protein Analysis

77

Amino Acids

8.5

Weight (kDa)

9.44

Isoelectric Point (pI)

43.39

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Mito_carr	PF00153	3 - 73	3e-08	Mitochondrial carrier protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004603)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G58970 AT5G58970
fragaria_vesca	FvH4_3g37720 FvH4_3g37720 FvH4_3g37720 FvH4_3g37720 FvH4_3g37720 FvH4_3g37720 FvH4_3g37720 FvH4_3g37720
malus_domestica	MD03G1078200.v1.1 MD11G1082900.v1.1
prunus_persica	Prupe.6G063200_v2.0.a1 Prupe.6G063200_v2.0.a1 Prupe.6G063200_v2.0.a1
pyrus_communis	pycom03g06250 pycom11g07100
rosa_chinensis	RchiOBHm_Chr1g0328771 RchiOBHm_Chr5g0067991
rosa_laevigata	RLG00000035950
rosa_multiflora	Rmu_sc0000435.1_g000035
rosa_roxburghii	Rroxscaffold_1G00012610 Rroxscaffold_1G00013320 Rroxscaffold_2G00133940
rosa_rugosa	Rorug05G0387100 Rorug05G0387100
rosa_samantha	Rh5AG446000 Rh5BG463500 Rh5CG485400 Rh5DG477500
rosa_wichuraiana	Rw5G041650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	212
AfaI	GTAC	2 cut(s)	10, 109
AfiI	CCNNNNNNNGG	1 cut(s)	126
AflII	CTTAAG	1 cut(s)	199
AjnI	CCWGG	1 cut(s)	166
AluBI	AGCT	3 cut(s)	46, 77, 146
AluI	AGCT	3 cut(s)	46, 77, 146
AlwI	GGATC	1 cut(s)	212
ApeKI	GCWGC	2 cut(s)	74, 143
BbvI	GCAGC	2 cut(s)	86, 155
BciT130I	CCWGG	1 cut(s)	168
BfaI	CTAG	1 cut(s)	126
BfrI	CTTAAG	1 cut(s)	199
BisI	GCNGC	2 cut(s)	75, 144
BlsI	GCNGC	2 cut(s)	76, 145
Bme1390I	CCNGG	1 cut(s)	168
BmiI	GGNNCC	1 cut(s)	41
BmrFI	CCNGG	1 cut(s)	168
BmsI	GCATC	3 cut(s)	61, 70, 195
BpmI	CTGGAG	1 cut(s)	26
BsaJI	CCNNGG	1 cut(s)	149
Bsc4I	CCNNNNNNNGG	1 cut(s)	126
Bse3DI	GCAATG	1 cut(s)	120
BseBI	CCWGG	1 cut(s)	168
BseDI	CCNNGG	1 cut(s)	149
BseGI	GGATG	1 cut(s)	76
BseLI	CCNNNNNNNGG	1 cut(s)	126
BseMI	GCAATG	1 cut(s)	120
BseXI	GCAGC	2 cut(s)	86, 155
BslI	CCNNNNNNNGG	1 cut(s)	126
Bsp143I	GATC	1 cut(s)	217
BspLI	GGNNCC	1 cut(s)	41
BspPI	GGATC	1 cut(s)	212
BspTI	CTTAAG	1 cut(s)	199
BsrDI	GCAATG	1 cut(s)	120
BssECI	CCNNGG	1 cut(s)	149
BssMI	GATC	1 cut(s)	217
BssT1I	CCWWGG	1 cut(s)	149
Bst2UI	CCWGG	1 cut(s)	168
BstAFI	CTTAAG	1 cut(s)	199
BstAPI	GCANNNNNTGC	1 cut(s)	80
BstF5I	GGATG	1 cut(s)	76
BstKTI	GATC	1 cut(s)	220
BstMBI	GATC	1 cut(s)	217
BstMWI	GCNNNNNNNGC	2 cut(s)	80, 122
BstNI	CCWGG	1 cut(s)	168
BstSCI	CCNGG	1 cut(s)	166
BstV1I	GCAGC	2 cut(s)	86, 155
BstXI	CCANNNNNNTGG	1 cut(s)	19
BtgZI	GCGATG	1 cut(s)	10
BtsCI	GGATG	1 cut(s)	76
Csp6I	GTAC	2 cut(s)	9, 108
CviJI	RGCY	7 cut(s)	40, 46, 77, 99, 116, 146, 198
CviKI_1	RGCY	7 cut(s)	40, 46, 77, 99, 116, 146, 198
CviQI	GTAC	2 cut(s)	9, 108
DpnI	GATC	1 cut(s)	219
DpnII	GATC	1 cut(s)	217
Eco130I	CCWWGG	1 cut(s)	149
EcoRII	CCWGG	1 cut(s)	166
EcoT14I	CCWWGG	1 cut(s)	149
EcoT22I	ATGCAT	1 cut(s)	188
ErhI	CCWWGG	1 cut(s)	149
FaiI	YATR	6 cut(s)	93, 113, 161, 192, 214, 216
Fnu4HI	GCNGC	2 cut(s)	75, 144
FokI	GGATG	1 cut(s)	83
Fsp4HI	GCNGC	2 cut(s)	75, 144
FspBI	CTAG	1 cut(s)	126
GluI	GCNGC	2 cut(s)	75, 144
GsuI	CTGGAG	1 cut(s)	26
HpyAV	CCTTC	1 cut(s)	128
HpyCH4V	TGCA	3 cut(s)	74, 83, 186
HpyF10VI	GCNNNNNNNGC	2 cut(s)	80, 122
Kzo9I	GATC	1 cut(s)	217
LmnI	GCTCC	3 cut(s)	45, 51, 151
LpnPI	CCDG	3 cut(s)	56, 153, 180
Lsp1109I	GCAGC	2 cut(s)	86, 155
LweI	GCATC	3 cut(s)	61, 70, 195
MaeI	CTAG	1 cut(s)	126
MalI	GATC	1 cut(s)	219
MboI	GATC	1 cut(s)	217
MboII	GAAGA	1 cut(s)	143
MluCI	AATT	2 cut(s)	162, 204
MnlI	CCTC	1 cut(s)	188
Mph1103I	ATGCAT	1 cut(s)	188
MseI	TTAA	2 cut(s)	200, 232
MspA1I	CMGCKG	1 cut(s)	77
MspCI	CTTAAG	1 cut(s)	199
MspR9I	CCNGG	1 cut(s)	168
MvaI	CCWGG	1 cut(s)	168
MwoI	GCNNNNNNNGC	2 cut(s)	80, 122
NdeII	GATC	1 cut(s)	217
NlaIV	GGNNCC	1 cut(s)	41
NsiI	ATGCAT	1 cut(s)	188
PfoI	TCCNGGA	1 cut(s)	166
PkrI	GCNGC	2 cut(s)	76, 145
Psp6I	CCWGG	1 cut(s)	166
PspGI	CCWGG	1 cut(s)	166
PspN4I	GGNNCC	1 cut(s)	41
PvuII	CAGCTG	1 cut(s)	77
RsaI	GTAC	2 cut(s)	10, 109
RsaNI	GTAC	2 cut(s)	9, 108
SaqAI	TTAA	2 cut(s)	200, 232
SatI	GCNGC	2 cut(s)	75, 144
Sau3AI	GATC	1 cut(s)	217
ScrFI	CCNGG	1 cut(s)	168
SetI	ASST	6 cut(s)	48, 79, 88, 139, 148, 212
SfaNI	GCATC	3 cut(s)	61, 70, 195
SgeI	CNNG	6 cut(s)	55, 112, 138, 162, 179, 180
SmlI	CTYRAG	1 cut(s)	199
SmoI	CTYRAG	1 cut(s)	199
Sse9I	AATT	2 cut(s)	162, 204
SspMI	CTAG	1 cut(s)	126
StyD4I	CCNGG	1 cut(s)	166
StyI	CCWWGG	1 cut(s)	149
TasI	AATT	2 cut(s)	162, 204
Tru1I	TTAA	2 cut(s)	200, 232
Tru9I	TTAA	2 cut(s)	200, 232
TseI	GCWGC	2 cut(s)	74, 143
Vha464I	CTTAAG	1 cut(s)	199
XspI	CTAG	1 cut(s)	126
Zsp2I	ATGCAT	1 cut(s)	188

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.