RchiOBHm_Chr1g0347551

C2 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
40192445 .. 40197948
5504 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGAGAGTTCTCCGCCAGTCTACTGGTGATAACCATTTGATTTTGCACTTGGGAATAAATTTTCTGATAGCTGATGATATGCTTGGAATACTTGCTGTCAAGCTAAAGAAAGGATCGGCTTTGGCTTTGTGGGCAGTGAAGACTCGGAAAGTATACACCCAAGATGAACTTGACGAGGTCCGCATTGAAGTAGATGACTATTTGCAGACTTTGCTATAG

Protein Analysis

72

Amino Acids

8.19

Weight (kDa)

6.03

Isoelectric Point (pI)

22.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 20, 153
AciI CCGC 2 cut(s) 13, 181
AclWI GGATC 1 cut(s) 121
AcsI RAATTY 1 cut(s) 58
AgsI TTSAA 1 cut(s) 188
AluBI AGCT 2 cut(s) 71, 103
AluI AGCT 2 cut(s) 71, 103
AlwI GGATC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 58
AspS9I GGNCC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 38
AvaII GGWCC 1 cut(s) 178
BbsI GAAGAC 1 cut(s) 146
BfmI CTRYAG 1 cut(s) 215
Bme18I GGWCC 1 cut(s) 178
BmgT120I GGNCC 1 cut(s) 178
BpiI GAAGAC 1 cut(s) 146
Bse1I ACTGG 2 cut(s) 16, 28
BseNI ACTGG 2 cut(s) 16, 28
Bsp143I GATC 1 cut(s) 113
BspACI CCGC 2 cut(s) 13, 181
BspPI GGATC 1 cut(s) 121
BsrI ACTGG 2 cut(s) 16, 28
BssMI GATC 1 cut(s) 113
BssNAI GTATAC 1 cut(s) 154
Bst1107I GTATAC 1 cut(s) 154
BstAPI GCANNNNNTGC 1 cut(s) 211
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstMWI GCNNNNNNNGC 2 cut(s) 131, 211
BstSFI CTRYAG 1 cut(s) 215
BstV2I GAAGAC 1 cut(s) 146
BstXI CCANNNNNNTGG 1 cut(s) 23
BstZ17I GTATAC 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 178
CviJI RGCY 4 cut(s) 71, 103, 119, 125
CviKI_1 RGCY 4 cut(s) 71, 103, 119, 125
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
Eco47I GGWCC 1 cut(s) 178
FaiI YATR 3 cut(s) 80, 154, 217
FalI AAGNNNNNCTT 2 cut(s) 153, 185
FblI GTMKAC 2 cut(s) 20, 153
HinfI GANTC 1 cut(s) 142
HphI GGTGA 1 cut(s) 38
Hpy166II GTNNAC 2 cut(s) 21, 154
Hpy188I TCNGA 2 cut(s) 66, 147
Hpy8I GTNNAC 2 cut(s) 21, 154
HpyCH4V TGCA 2 cut(s) 46, 205
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 211
Kzo9I GATC 1 cut(s) 113
LpnPI CCDG 2 cut(s) 9, 29
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MboII GAAGA 1 cut(s) 151
MluCI AATT 1 cut(s) 58
MlyI GAGTC 1 cut(s) 136
MnlI CCTC 1 cut(s) 169
MwoI GCNNNNNNNGC 2 cut(s) 131, 211
NdeII GATC 1 cut(s) 113
PflFI GACNNNGTC 1 cut(s) 176
PleI GAGTC 1 cut(s) 136
PpsI GAGTC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 178
PsyI GACNNNGTC 1 cut(s) 176
Sau3AI GATC 1 cut(s) 113
Sau96I GGNCC 1 cut(s) 178
SchI GAGTC 1 cut(s) 136
SetI ASST 3 cut(s) 73, 105, 180
SfcI CTRYAG 1 cut(s) 215
SinI GGWCC 1 cut(s) 178
Sse9I AATT 1 cut(s) 58
SsiI CCGC 2 cut(s) 13, 181
TasI AATT 1 cut(s) 58
TscAI CASTG 1 cut(s) 141
TspDTI ATGAA 1 cut(s) 180
TspRI CASTG 1 cut(s) 141
Tth111I GACNNNGTC 1 cut(s) 176
VpaK11BI GGWCC 1 cut(s) 178
XapI RAATTY 1 cut(s) 58
XmiI GTMKAC 2 cut(s) 20, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.