RchiOBHm_Chr1g0352991

source UniProtKB

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
46343524 .. 46348796
5273 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGCGATACATGAAGGACATTATAAATGATGACACGCTTTCATTTCCGACCAAGTGGGCAGTGATGACTCGGAAAGTATACACCCAAGATGAACTTGACGAGGTCCGCATTGAAGTAGCTGACTATTTGCAGACTTTGCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.67

Weight (kDa)

4.52

Isoelectric Point (pI)

24.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AccI GTMKAC 1 cut(s) 78
AciI CCGC 1 cut(s) 106
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 103
AvaII GGWCC 1 cut(s) 103
BfmI CTRYAG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 103
BmgT120I GGNCC 1 cut(s) 103
BspACI CCGC 1 cut(s) 106
BssNAI GTATAC 1 cut(s) 79
Bst1107I GTATAC 1 cut(s) 79
BstAPI GCANNNNNTGC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstSFI CTRYAG 1 cut(s) 140
BstZ17I GTATAC 1 cut(s) 79
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 103
CviAII CATG 1 cut(s) 10
CviJI RGCY 1 cut(s) 119
CviKI_1 RGCY 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 103
FaeI CATG 1 cut(s) 13
FaiI YATR 4 cut(s) 11, 23, 79, 142
FalI AAGNNNNNCTT 2 cut(s) 78, 110
FatI CATG 1 cut(s) 9
FblI GTMKAC 1 cut(s) 78
FspEI CC 9 cut(s) 40, 41, 55, 60, 64, 86, 97, 98, 119
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 67
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 48, 72
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 130
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
Hsp92II CATG 1 cut(s) 13
MlyI GAGTC 1 cut(s) 61
MmeI TCCRAC 1 cut(s) 71
MnlI CCTC 1 cut(s) 94
MwoI GCNNNNNNNGC 1 cut(s) 136
NlaIII CATG 1 cut(s) 13
PflFI GACNNNGTC 1 cut(s) 101
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
PsiI TTATAA 1 cut(s) 23
PspPI GGNCC 1 cut(s) 103
PsyI GACNNNGTC 1 cut(s) 101
Sau96I GGNCC 1 cut(s) 103
SchI GAGTC 1 cut(s) 61
SetI ASST 2 cut(s) 105, 121
SfcI CTRYAG 1 cut(s) 140
SgeI CNNG 7 cut(s) 22, 46, 64, 81, 98, 107, 112
SinI GGWCC 1 cut(s) 103
SsiI CCGC 1 cut(s) 106
TscAI CASTG 1 cut(s) 66
TspDTI ATGAA 3 cut(s) 26, 30, 105
TspRI CASTG 1 cut(s) 66
Tth111I GACNNNGTC 1 cut(s) 101
VpaK11BI GGWCC 1 cut(s) 103
XmiI GTMKAC 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.