RchiOBHm_Chr1g0362851

RNA-binding protein 12-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0008166
Physical Location & Seq
Reverse (-)
54452044 .. 54452560
517 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 390 bp
ATGGCAGGCCTCAAGCATTGTTCCCTATTATCTATCATGGTAGCAGCATTGTGTTTGTCAAGCATTGACATGAGCTTCGGCGCCAGGCACCTGTTGCAGACATCAATTCCATTGATTCCAGTTCCCAAGGGTGCAGTGCCTCCACTGCCTATGCCAACTCCTCTGCCACCACTGCCAAAACCCACAACACAAATCCCACCTCTGCCAAGCACCCAAATCCCATCTCTACCTAATCCAACATTGCCAAACCTTCCCACTGCTCCCAAGTTCACTCTACCTCCACTTCCGGCCACTACATTCCCCACCTTCCCCACTACAATCCCTTCACTTCCCAACATTCCAACCACAATTCCATCAATTCCTTTTTTCTCACCTCCTCCATCGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

13.53

Weight (kDa)

9.7

Isoelectric Point (pI)

69.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 80, 87
AcoI YGGCCR 1 cut(s) 288
AcyI GRCGYC 1 cut(s) 81
AjnI CCWGG 1 cut(s) 83
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
AoxI GGCC 2 cut(s) 7, 288
ApeKI GCWGC 1 cut(s) 44
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AspLEI GCGC 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 363
BanI GGYRCC 2 cut(s) 80, 87
BbvI GCAGC 1 cut(s) 56
BccI CCATC 3 cut(s) 229, 361, 388
BciT130I CCWGG 1 cut(s) 85
BfoI RGCGCY 1 cut(s) 84
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 85
BmiI GGNNCC 2 cut(s) 82, 89
BmrFI CCNGG 1 cut(s) 85
BsaHI GRCGYC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 126
BsaXI ACNNNNNCTCC 2 cut(s) 262, 292
Bse1I ACTGG 1 cut(s) 119
Bse3DI GCAATG 1 cut(s) 239
BseBI CCWGG 1 cut(s) 85
BseDI CCNNGG 1 cut(s) 126
BseMI GCAATG 1 cut(s) 239
BseNI ACTGG 1 cut(s) 119
BseRI GAGGAG 2 cut(s) 150, 366
BseXI GCAGC 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 153
BshFI GGCC 2 cut(s) 9, 290
BshNI GGYRCC 2 cut(s) 80, 87
BsiSI CCGG 1 cut(s) 287
BsnI GGCC 2 cut(s) 9, 290
BspANI GGCC 2 cut(s) 9, 290
BspLI GGNNCC 2 cut(s) 82, 89
BspT107I GGYRCC 2 cut(s) 80, 87
BsrDI GCAATG 1 cut(s) 239
BsrI ACTGG 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 126
BssNI GRCGYC 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 85
BstACI GRCGYC 1 cut(s) 81
BstAPI GCANNNNNTGC 1 cut(s) 94
BstC8I GCNNGC 1 cut(s) 7
BstH2I RGCGCY 1 cut(s) 84
BstHHI GCGC 1 cut(s) 83
BstMWI GCNNNNNNNGC 3 cut(s) 94, 145, 172
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 56
BsuRI GGCC 2 cut(s) 9, 290
BtsI GCAGTG 4 cut(s) 141, 143, 170, 255
BtsIMutI CAGTG 4 cut(s) 141, 143, 170, 255
Cac8I GCNNGC 1 cut(s) 7
CfoI GCGC 1 cut(s) 83
CviAII CATG 2 cut(s) 37, 70
CviJI RGCY 3 cut(s) 9, 75, 290
CviKI_1 RGCY 3 cut(s) 9, 75, 290
DinI GGCGCC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 288
Eco130I CCWWGG 1 cut(s) 126
Eco147I AGGCCT 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 126
EgeI GGCGCC 1 cut(s) 82
EheI GGCGCC 1 cut(s) 82
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 2 cut(s) 40, 73
FaiI YATR 3 cut(s) 38, 71, 152
FatI CATG 2 cut(s) 36, 69
Fnu4HI GCNGC 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 45
GlaI GCGC 1 cut(s) 82
GluI GCNGC 1 cut(s) 45
HaeII RGCGCY 1 cut(s) 84
HaeIII GGCC 2 cut(s) 9, 290
HapII CCGG 1 cut(s) 287
HhaI GCGC 1 cut(s) 83
Hin1I GRCGYC 1 cut(s) 81
Hin1II CATG 2 cut(s) 40, 73
Hin6I GCGC 1 cut(s) 81
HinP1I GCGC 1 cut(s) 81
HinfI GANTC 1 cut(s) 115
HpaII CCGG 1 cut(s) 287
HphI GGTGA 1 cut(s) 363
Hpy166II GTNNAC 1 cut(s) 270
Hpy8I GTNNAC 1 cut(s) 270
HpyAV CCTTC 3 cut(s) 260, 316, 333
HpyCH4V TGCA 2 cut(s) 97, 134
HpyF10VI GCNNNNNNNGC 3 cut(s) 94, 145, 172
Hsp92I GRCGYC 1 cut(s) 81
Hsp92II CATG 2 cut(s) 40, 73
HspAI GCGC 1 cut(s) 81
KasI GGCGCC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 265
LpnPI CCDG 5 cut(s) 70, 97, 104, 132, 300
Lsp1109I GCAGC 1 cut(s) 56
MluCI AATT 4 cut(s) 105, 348, 357, 385
Mly113I GGCGCC 1 cut(s) 81
MmeI TCCRAC 2 cut(s) 260, 365
MnlI CCTC 7 cut(s) 20, 150, 171, 210, 288, 384, 387
MseI TTAA 1 cut(s) 388
MslI CAYNNNNRTG 1 cut(s) 68
MspI CCGG 1 cut(s) 287
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
MwoI GCNNNNNNNGC 3 cut(s) 94, 145, 172
NarI GGCGCC 1 cut(s) 81
NlaIII CATG 2 cut(s) 40, 73
NlaIV GGNNCC 2 cut(s) 82, 89
PceI AGGCCT 1 cut(s) 9
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 1 cut(s) 46
PluTI GGCGCC 1 cut(s) 84
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspN4I GGNNCC 2 cut(s) 82, 89
RseI CAYNNNNRTG 1 cut(s) 68
SaqAI TTAA 1 cut(s) 388
SatI GCNGC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 85
SetI ASST 8 cut(s) 77, 93, 202, 232, 252, 280, 308, 376
SfoI GGCGCC 1 cut(s) 82
SmiMI CAYNNNNRTG 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 4 cut(s) 105, 348, 357, 385
SseBI AGGCCT 1 cut(s) 9
SspDI GGCGCC 1 cut(s) 80
StuI AGGCCT 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 83
StyI CCWWGG 1 cut(s) 126
TaqI TCGA 1 cut(s) 383
TasI AATT 4 cut(s) 105, 348, 357, 385
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 388
Tru9I TTAA 1 cut(s) 388
TscAI CASTG 4 cut(s) 141, 150, 177, 262
TseI GCWGC 1 cut(s) 44
TspRI CASTG 4 cut(s) 141, 150, 177, 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.