Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0008166

Physical Location & Seq

Genomic Coordinates Reverse (-)

13731649 .. 13732579

Gene Structure 931 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00293460.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

ATGGCAGGCCTCATGCATTGTTCCCTATTATCTATCATGGTAGCGGCATTGTGTTTGTCAAGCATTGACATGAGCTTTGGCGCCAGGCACCTGTTGCAGACATCAATTCCATCGATTCCGATTCCCAAGGGTGCATTGCCTCCACTGCCTTCCACACTGCCTATGCCAACTTCACTGCCACAATTGCCAACATTGCCAAAACCCACAACACAAATCCCATCTCTGCCAAGCACCCAAATCCCATCTCTACCAAATCCAACAATGCCAAACCTTCCCACAGCTCCTAAGTTCACCCTACCTCCACTTCCAACTACATTCCCCACCATCCCCACTACGATCCCTCCACTTCCCACCTTTCCAACCACAATTCCAACAGTTCCATCCCTCTCACCTCCGTCGAATTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

134

Amino Acids

14.01

Weight (kDa)

9.39

Isoelectric Point (pI)

70.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008166)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0362851 RchiOBHm_Chr2g0111371
rosa_laevigata	RLG00000017890 RLG00000017892
rosa_multiflora	Rmu_ssc0000075.1_g000005 Rmu_ssc0000075.1_g000007
rosa_roxburghii	Rroxscaffold_2G00132440 Rroxscaffold_2G00132450 Rroxscaffold_4G00293440 Rroxscaffold_4G00293460
rosa_rugosa	Rorug02G0173200 Rorug02G0173300
rosa_samantha	Rh1BG276800 Rh1CG291100 Rh2AG226400 Rh2AG226500 Rh2BG238100 Rh2BG238200 Rh2CG229500 Rh2CG229600 Rh2DG233800 Rh2DG233900
rosa_wichuraiana	Rw1G027550 Rw1G027780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	80, 87
AciI	CCGC	1 cut(s)	44
AclWI	GGATC	1 cut(s)	331
AcyI	GRCGYC	1 cut(s)	81
AjnI	CCWGG	1 cut(s)	83
AluBI	AGCT	2 cut(s)	75, 281
AluI	AGCT	2 cut(s)	75, 281
AlwI	GGATC	1 cut(s)	331
AoxI	GGCC	1 cut(s)	7
ArsI	GACNNNNNNTTYG	2 cut(s)	59, 91
AspLEI	GCGC	1 cut(s)	83
AsuHPI	GGTGA	2 cut(s)	283, 381
BanI	GGYRCC	2 cut(s)	80, 87
BccI	CCATC	5 cut(s)	118, 226, 250, 332, 388
BciT130I	CCWGG	1 cut(s)	85
BfoI	RGCGCY	1 cut(s)	84
BisI	GCNGC	1 cut(s)	45
BlsI	GCNGC	1 cut(s)	46
Bme1390I	CCNGG	1 cut(s)	85
BmiI	GGNNCC	2 cut(s)	82, 89
BmrFI	CCNGG	1 cut(s)	85
Bsa29I	ATCGAT	1 cut(s)	113
BsaHI	GRCGYC	1 cut(s)	81
BsaJI	CCNNGG	1 cut(s)	126
BsaXI	ACNNNNNCTCC	4 cut(s)	283, 313, 325, 355
Bse3DI	GCAATG	2 cut(s)	134, 191
BseBI	CCWGG	1 cut(s)	85
BseCI	ATCGAT	1 cut(s)	113
BseDI	CCNNGG	1 cut(s)	126
BseGI	GGATG	2 cut(s)	324, 380
BseMI	GCAATG	2 cut(s)	134, 191
BshFI	GGCC	1 cut(s)	9
BshNI	GGYRCC	2 cut(s)	80, 87
BshVI	ATCGAT	1 cut(s)	113
BsnI	GGCC	1 cut(s)	9
Bsp143I	GATC	1 cut(s)	336
BspACI	CCGC	1 cut(s)	44
BspANI	GGCC	1 cut(s)	9
BspDI	ATCGAT	1 cut(s)	113
BspLI	GGNNCC	2 cut(s)	82, 89
BspPI	GGATC	1 cut(s)	331
BspT107I	GGYRCC	2 cut(s)	80, 87
BsrDI	GCAATG	2 cut(s)	134, 191
BssECI	CCNNGG	1 cut(s)	126
BssMI	GATC	1 cut(s)	336
BssNI	GRCGYC	1 cut(s)	81
BssT1I	CCWWGG	1 cut(s)	126
Bst2UI	CCWGG	1 cut(s)	85
Bst4CI	ACNGT	1 cut(s)	376
BstACI	GRCGYC	1 cut(s)	81
BstAPI	GCANNNNNTGC	1 cut(s)	94
BstC8I	GCNNGC	1 cut(s)	7
BstDEI	CTNAG	1 cut(s)	285
BstF5I	GGATG	2 cut(s)	324, 380
BstH2I	RGCGCY	1 cut(s)	84
BstHHI	GCGC	1 cut(s)	83
BstKTI	GATC	1 cut(s)	339
BstMBI	GATC	1 cut(s)	336
BstMWI	GCNNNNNNNGC	4 cut(s)	94, 145, 184, 193
BstNI	CCWGG	1 cut(s)	85
BstSCI	CCNGG	1 cut(s)	83
Bsu15I	ATCGAT	1 cut(s)	113
BsuRI	GGCC	1 cut(s)	9
BsuTUI	ATCGAT	1 cut(s)	113
BtsCI	GGATG	2 cut(s)	324, 380
BtsI	GCAGTG	3 cut(s)	143, 155, 173
BtsIMutI	CAGTG	3 cut(s)	143, 155, 173
Cac8I	GCNNGC	1 cut(s)	7
CfoI	GCGC	1 cut(s)	83
ClaI	ATCGAT	1 cut(s)	113
CviAII	CATG	3 cut(s)	13, 37, 70
CviJI	RGCY	3 cut(s)	9, 75, 281
CviKI_1	RGCY	3 cut(s)	9, 75, 281
DdeI	CTNAG	1 cut(s)	285
DinI	GGCGCC	1 cut(s)	82
DpnI	GATC	1 cut(s)	338
DpnII	GATC	1 cut(s)	336
Eco130I	CCWWGG	1 cut(s)	126
Eco147I	AGGCCT	1 cut(s)	9
EcoRII	CCWGG	1 cut(s)	83
EcoT14I	CCWWGG	1 cut(s)	126
EcoT22I	ATGCAT	1 cut(s)	18
EgeI	GGCGCC	1 cut(s)	82
EheI	GGCGCC	1 cut(s)	82
ErhI	CCWWGG	1 cut(s)	126
FaeI	CATG	3 cut(s)	16, 40, 73
FaiI	YATR	4 cut(s)	14, 38, 71, 164
FatI	CATG	3 cut(s)	12, 36, 69
Fnu4HI	GCNGC	1 cut(s)	45
FokI	GGATG	2 cut(s)	311, 367
Fsp4HI	GCNGC	1 cut(s)	45
GlaI	GCGC	1 cut(s)	82
GluI	GCNGC	1 cut(s)	45
HaeII	RGCGCY	1 cut(s)	84
HaeIII	GGCC	1 cut(s)	9
HhaI	GCGC	1 cut(s)	83
Hin1I	GRCGYC	1 cut(s)	81
Hin1II	CATG	3 cut(s)	16, 40, 73
Hin6I	GCGC	1 cut(s)	81
HinP1I	GCGC	1 cut(s)	81
HinfI	GANTC	2 cut(s)	115, 121
HphI	GGTGA	2 cut(s)	283, 381
Hpy166II	GTNNAC	1 cut(s)	291
Hpy188I	TCNGA	1 cut(s)	120
Hpy8I	GTNNAC	1 cut(s)	291
Hpy99I	CGWCG	1 cut(s)	400
HpyAV	CCTTC	2 cut(s)	159, 281
HpyCH4III	ACNGT	1 cut(s)	376
HpyCH4V	TGCA	3 cut(s)	16, 97, 134
HpyF10VI	GCNNNNNNNGC	4 cut(s)	94, 145, 184, 193
HpyF3I	CTNAG	1 cut(s)	285
Hsp92I	GRCGYC	1 cut(s)	81
Hsp92II	CATG	3 cut(s)	16, 40, 73
HspAI	GCGC	1 cut(s)	81
KasI	GGCGCC	1 cut(s)	80
Kzo9I	GATC	1 cut(s)	336
LmnI	GCTCC	1 cut(s)	286
LpnPI	CCDG	3 cut(s)	70, 97, 104
MalI	GATC	1 cut(s)	338
MboI	GATC	1 cut(s)	336
MfeI	CAATTG	1 cut(s)	182
MluCI	AATT	4 cut(s)	105, 182, 366, 400
Mly113I	GGCGCC	1 cut(s)	81
MmeI	TCCRAC	4 cut(s)	281, 332, 383, 395
MnlI	CCTC	6 cut(s)	20, 150, 309, 351, 395, 402
Mph1103I	ATGCAT	1 cut(s)	18
MseI	TTAA	1 cut(s)	403
MslI	CAYNNNNRTG	1 cut(s)	68
MspR9I	CCNGG	1 cut(s)	85
MunI	CAATTG	1 cut(s)	182
MvaI	CCWGG	1 cut(s)	85
MwoI	GCNNNNNNNGC	4 cut(s)	94, 145, 184, 193
NarI	GGCGCC	1 cut(s)	81
NdeII	GATC	1 cut(s)	336
NlaIII	CATG	3 cut(s)	16, 40, 73
NlaIV	GGNNCC	2 cut(s)	82, 89
NsiI	ATGCAT	1 cut(s)	18
PceI	AGGCCT	1 cut(s)	9
PfeI	GAWTC	2 cut(s)	115, 121
PkrI	GCNGC	1 cut(s)	46
PluTI	GGCGCC	1 cut(s)	84
Psp6I	CCWGG	1 cut(s)	83
PspGI	CCWGG	1 cut(s)	83
PspN4I	GGNNCC	2 cut(s)	82, 89
RseI	CAYNNNNRTG	1 cut(s)	68
SaqAI	TTAA	1 cut(s)	403
SatI	GCNGC	1 cut(s)	45
Sau3AI	GATC	1 cut(s)	336
ScrFI	CCNGG	1 cut(s)	85
SetI	ASST	7 cut(s)	77, 93, 273, 283, 301, 356, 394
SfoI	GGCGCC	1 cut(s)	82
SmiMI	CAYNNNNRTG	1 cut(s)	68
Sse9I	AATT	4 cut(s)	105, 182, 366, 400
SseBI	AGGCCT	1 cut(s)	9
SsiI	CCGC	1 cut(s)	44
SspDI	GGCGCC	1 cut(s)	80
StuI	AGGCCT	1 cut(s)	9
StyD4I	CCNGG	1 cut(s)	83
StyI	CCWWGG	1 cut(s)	126
TaaI	ACNGT	1 cut(s)	376
TaqI	TCGA	2 cut(s)	113, 398
TasI	AATT	4 cut(s)	105, 182, 366, 400
TauI	GCSGC	1 cut(s)	47
TfiI	GAWTC	2 cut(s)	115, 121
Tru1I	TTAA	1 cut(s)	403
Tru9I	TTAA	1 cut(s)	403
TscAI	CASTG	3 cut(s)	150, 162, 180
TspGWI	ACGGA	1 cut(s)	384
TspRI	CASTG	3 cut(s)	150, 162, 180
Zsp2I	ATGCAT	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.