Rh1CG291100

RNA-binding protein 12-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0008166
Physical Location & Seq
Reverse (-)
56449373 .. 56449935
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG291100.1

Sequence Viewer

Length: 399 bp
ATGGCAGGCCTCAAGCATTGTTCCCTATTATCTATCATGGTAGCAGCATTGTGTTTGTCAAGCATTGACATGAGCTTCGGCGCCAGGCACCTGTTGCAGACATCAGTTCCATTGATTCCGGTTCCCAAGGGTGCAGTGCCTACACTGCCTATGCCAACTCCTCTGCCACCATTGCCACCACTGCCAAAACCCACAACACAAATCCCACCTCTGCCAAGCACCCAAATCCCATCTCTACCTAATCCAACATTGCCAAACCTTCCCACTGCTCCCAAGTTCACTCTACCTCCACTTCCGGCCACTACATTCCCCACCTTCCCCACTACAATCCCTTCACTTCCCAACATTCCAACCACAATTCCATCAATTCCTTTCTTCTCACCTCCTCCCTCGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

13.83

Weight (kDa)

9.7

Isoelectric Point (pI)

71.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 80, 87
AcoI YGGCCR 1 cut(s) 297
AcyI GRCGYC 1 cut(s) 81
AjnI CCWGG 1 cut(s) 83
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
AoxI GGCC 2 cut(s) 7, 297
ApeKI GCWGC 1 cut(s) 44
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AspLEI GCGC 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 372
BanI GGYRCC 2 cut(s) 80, 87
BbvI GCAGC 1 cut(s) 56
BccI CCATC 2 cut(s) 238, 370
BciT130I CCWGG 1 cut(s) 85
BfoI RGCGCY 1 cut(s) 84
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 85
BmiI GGNNCC 3 cut(s) 82, 89, 123
BmrFI CCNGG 1 cut(s) 85
BsaHI GRCGYC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 126
BsaWI WCCGGW 1 cut(s) 118
BsaXI ACNNNNNCTCC 2 cut(s) 271, 301
Bse3DI GCAATG 2 cut(s) 170, 248
BseBI CCWGG 1 cut(s) 85
BseDI CCNNGG 1 cut(s) 126
BseMI GCAATG 2 cut(s) 170, 248
BseRI GAGGAG 2 cut(s) 150, 375
BseXI GCAGC 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 153
BshFI GGCC 2 cut(s) 9, 299
BshNI GGYRCC 2 cut(s) 80, 87
BsiSI CCGG 2 cut(s) 119, 296
BsnI GGCC 2 cut(s) 9, 299
BspANI GGCC 2 cut(s) 9, 299
BspLI GGNNCC 3 cut(s) 82, 89, 123
BspT107I GGYRCC 2 cut(s) 80, 87
BsrDI GCAATG 2 cut(s) 170, 248
BssECI CCNNGG 1 cut(s) 126
BssNI GRCGYC 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 85
BstACI GRCGYC 1 cut(s) 81
BstAPI GCANNNNNTGC 1 cut(s) 94
BstC8I GCNNGC 1 cut(s) 7
BstH2I RGCGCY 1 cut(s) 84
BstHHI GCGC 1 cut(s) 83
BstMWI GCNNNNNNNGC 4 cut(s) 94, 145, 172, 181
BstNI CCWGG 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 83
BstV1I GCAGC 1 cut(s) 56
BsuRI GGCC 2 cut(s) 9, 299
BtsI GCAGTG 4 cut(s) 141, 143, 179, 264
BtsIMutI CAGTG 4 cut(s) 141, 143, 179, 264
Cac8I GCNNGC 1 cut(s) 7
CfoI GCGC 1 cut(s) 83
CviAII CATG 2 cut(s) 37, 70
CviJI RGCY 3 cut(s) 9, 75, 299
CviKI_1 RGCY 3 cut(s) 9, 75, 299
DinI GGCGCC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 297
Eco130I CCWWGG 1 cut(s) 126
Eco147I AGGCCT 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 126
EgeI GGCGCC 1 cut(s) 82
EheI GGCGCC 1 cut(s) 82
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 2 cut(s) 40, 73
FaiI YATR 3 cut(s) 38, 71, 152
FatI CATG 2 cut(s) 36, 69
Fnu4HI GCNGC 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 45
GlaI GCGC 1 cut(s) 82
GluI GCNGC 1 cut(s) 45
HaeII RGCGCY 1 cut(s) 84
HaeIII GGCC 2 cut(s) 9, 299
HapII CCGG 2 cut(s) 119, 296
HhaI GCGC 1 cut(s) 83
Hin1I GRCGYC 1 cut(s) 81
Hin1II CATG 2 cut(s) 40, 73
Hin6I GCGC 1 cut(s) 81
HinP1I GCGC 1 cut(s) 81
HinfI GANTC 1 cut(s) 115
HpaII CCGG 2 cut(s) 119, 296
HphI GGTGA 1 cut(s) 372
Hpy166II GTNNAC 1 cut(s) 279
Hpy8I GTNNAC 1 cut(s) 279
HpyAV CCTTC 3 cut(s) 269, 325, 342
HpyCH4V TGCA 2 cut(s) 97, 134
HpyF10VI GCNNNNNNNGC 4 cut(s) 94, 145, 172, 181
Hsp92I GRCGYC 1 cut(s) 81
Hsp92II CATG 2 cut(s) 40, 73
HspAI GCGC 1 cut(s) 81
KasI GGCGCC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 274
LpnPI CCDG 5 cut(s) 70, 97, 104, 132, 309
Lsp1109I GCAGC 1 cut(s) 56
MboII GAAGA 1 cut(s) 367
MluCI AATT 3 cut(s) 357, 366, 394
Mly113I GGCGCC 1 cut(s) 81
MmeI TCCRAC 2 cut(s) 269, 374
MnlI CCTC 6 cut(s) 20, 171, 219, 297, 393, 396
MseI TTAA 1 cut(s) 397
MslI CAYNNNNRTG 1 cut(s) 68
MspI CCGG 2 cut(s) 119, 296
MspR9I CCNGG 1 cut(s) 85
MvaI CCWGG 1 cut(s) 85
MwoI GCNNNNNNNGC 4 cut(s) 94, 145, 172, 181
NarI GGCGCC 1 cut(s) 81
NlaIII CATG 2 cut(s) 40, 73
NlaIV GGNNCC 3 cut(s) 82, 89, 123
PceI AGGCCT 1 cut(s) 9
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 1 cut(s) 46
PluTI GGCGCC 1 cut(s) 84
Psp6I CCWGG 1 cut(s) 83
PspGI CCWGG 1 cut(s) 83
PspN4I GGNNCC 3 cut(s) 82, 89, 123
RseI CAYNNNNRTG 1 cut(s) 68
SaqAI TTAA 1 cut(s) 397
SatI GCNGC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 85
SetI ASST 8 cut(s) 77, 93, 211, 241, 261, 289, 317, 385
SfoI GGCGCC 1 cut(s) 82
SmiMI CAYNNNNRTG 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 11
SmoI CTYRAG 1 cut(s) 11
Sse9I AATT 3 cut(s) 357, 366, 394
SseBI AGGCCT 1 cut(s) 9
SspDI GGCGCC 1 cut(s) 80
StuI AGGCCT 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 83
StyI CCWWGG 1 cut(s) 126
TaqI TCGA 1 cut(s) 392
TasI AATT 3 cut(s) 357, 366, 394
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 397
Tru9I TTAA 1 cut(s) 397
TscAI CASTG 4 cut(s) 141, 150, 186, 271
TseI GCWGC 1 cut(s) 44
TspRI CASTG 4 cut(s) 141, 150, 186, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.