Rmu_ssc0000075.1_g000007

RNA-binding protein 12-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000075.1
OG0008166
Physical Location & Seq
Forward (+)
37204 .. 37635
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000075.1_g000007.1.cds

Sequence Viewer

Length: 432 bp
atggcaggtttccagcattgtttcctgctttccatggtggtagcggcattgtgtttgtctagcattgatacgagcttcgcagctcgacaccttctgcaggctccagcattaccacagcctacaattccgtctcttcccaaggttacaatgcctccactgccttccttgccaacaggactgcctcaacccacactgccaacatttccaaccaaccccatcccacctctgccgaaagccacattgccaccattgccaagcacccaaatcccatctctgccaaaccctaccttgccaacaattccaagctctgttcccaaggtgactcttccaccacttccagccactccattgcccaccatcccaaccaagattccttcattgcccaccattccaaccacaattccaactgttccgtctcctccctcaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

14.83

Weight (kDa)

9.7

Isoelectric Point (pI)

68.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 97
AluBI AGCT 3 cut(s) 75, 83, 306
AluI AGCT 3 cut(s) 75, 83, 306
Alw26I GTCTC 2 cut(s) 135, 420
ApeKI GCWGC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 331
BbvI GCAGC 1 cut(s) 92
BccI CCATC 3 cut(s) 224, 277, 365
BcoDI GTCTC 2 cut(s) 135, 420
BfaI CTAG 1 cut(s) 60
BfmI CTRYAG 1 cut(s) 95
BisI GCNGC 2 cut(s) 45, 81
BlsI GCNGC 2 cut(s) 46, 82
BmiI GGNNCC 1 cut(s) 102
BpmI CTGGAG 1 cut(s) 87
BsaJI CCNNGG 3 cut(s) 33, 138, 315
BsaXI ACNNNNNCTCC 2 cut(s) 136, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 97
Bse3DI GCAATG 4 cut(s) 239, 248, 347, 377
BseDI CCNNGG 3 cut(s) 33, 138, 315
BseGI GGATG 2 cut(s) 216, 357
BseLI CCNNNNNNNGG 1 cut(s) 97
BseMI GCAATG 4 cut(s) 239, 248, 347, 377
BseRI GAGGAG 1 cut(s) 408
BseXI GCAGC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 97
BsmAI GTCTC 2 cut(s) 135, 420
BsmBI CGTCTC 2 cut(s) 135, 420
Bsp19I CCATGG 1 cut(s) 33
BspACI CCGC 1 cut(s) 44
BspLI GGNNCC 1 cut(s) 102
BspMAI CTGCAG 1 cut(s) 99
BsrDI GCAATG 4 cut(s) 239, 248, 347, 377
BssECI CCNNGG 3 cut(s) 33, 138, 315
BssT1I CCWWGG 3 cut(s) 33, 138, 315
Bst4CI ACNGT 1 cut(s) 409
Bst6I CTCTTC 2 cut(s) 138, 330
BstC8I GCNNGC 1 cut(s) 99
BstDSI CCRYGG 1 cut(s) 33
BstENI CCTNNNNNAGG 1 cut(s) 95
BstF5I GGATG 2 cut(s) 216, 357
BstMAI GTCTC 2 cut(s) 135, 420
BstMWI GCNNNNNNNGC 3 cut(s) 157, 166, 250
BstSFI CTRYAG 1 cut(s) 95
BstV1I GCAGC 1 cut(s) 92
BtgI CCRYGG 1 cut(s) 33
BtsCI GGATG 2 cut(s) 216, 357
BtsI GCAGTG 2 cut(s) 155, 191
BtsIMutI CAGTG 2 cut(s) 155, 191
Cac8I GCNNGC 1 cut(s) 99
CviAII CATG 1 cut(s) 34
CviJI RGCY 7 cut(s) 75, 83, 101, 118, 236, 306, 341
CviKI_1 RGCY 7 cut(s) 75, 83, 101, 118, 236, 306, 341
Eam1104I CTCTTC 2 cut(s) 138, 330
EarI CTCTTC 2 cut(s) 138, 330
Eco130I CCWWGG 3 cut(s) 33, 138, 315
EcoNI CCTNNNNNAGG 1 cut(s) 95
EcoT14I CCWWGG 3 cut(s) 33, 138, 315
ErhI CCWWGG 3 cut(s) 33, 138, 315
Esp3I CGTCTC 2 cut(s) 135, 420
FaeI CATG 1 cut(s) 37
FaiI YATR 1 cut(s) 35
FatI CATG 1 cut(s) 33
Fnu4HI GCNGC 2 cut(s) 45, 81
FokI GGATG 2 cut(s) 203, 344
Fsp4HI GCNGC 2 cut(s) 45, 81
FspBI CTAG 1 cut(s) 60
GluI GCNGC 2 cut(s) 45, 81
GsuI CTGGAG 1 cut(s) 87
Hin1II CATG 1 cut(s) 37
HinfI GANTC 2 cut(s) 322, 370
HphI GGTGA 1 cut(s) 331
HpyAV CCTTC 3 cut(s) 101, 171, 384
HpyCH4III ACNGT 1 cut(s) 409
HpyCH4V TGCA 1 cut(s) 97
HpyF10VI GCNNNNNNNGC 3 cut(s) 157, 166, 250
Hsp92II CATG 1 cut(s) 37
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 6 cut(s) 26, 38, 83, 117, 159, 351
Lsp1109I GCAGC 1 cut(s) 92
MaeI CTAG 1 cut(s) 60
MaeIII GTNAC 2 cut(s) 142, 319
MboII GAAGA 2 cut(s) 125, 317
MluCI AATT 4 cut(s) 123, 297, 399, 427
MlyI GAGTC 1 cut(s) 316
MmeI TCCRAC 3 cut(s) 230, 416, 428
MnlI CCTC 4 cut(s) 162, 192, 234, 429
MseI TTAA 1 cut(s) 430
MwoI GCNNNNNNNGC 3 cut(s) 157, 166, 250
NcoI CCATGG 1 cut(s) 33
NlaIII CATG 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 102
NmuCI GTSAC 1 cut(s) 319
PfeI GAWTC 1 cut(s) 370
PkrI GCNGC 2 cut(s) 46, 82
PleI GAGTC 1 cut(s) 316
PpsI GAGTC 1 cut(s) 316
PspN4I GGNNCC 1 cut(s) 102
PstI CTGCAG 1 cut(s) 99
SaqAI TTAA 1 cut(s) 430
SatI GCNGC 2 cut(s) 45, 81
SchI GAGTC 1 cut(s) 316
SetI ASST 9 cut(s) 10, 77, 85, 93, 144, 226, 290, 308, 321
SfcI CTRYAG 1 cut(s) 95
Sse9I AATT 4 cut(s) 123, 297, 399, 427
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 60
StyI CCWWGG 3 cut(s) 33, 138, 315
TaaI ACNGT 1 cut(s) 409
TaqI TCGA 1 cut(s) 85
TasI AATT 4 cut(s) 123, 297, 399, 427
TauI GCSGC 1 cut(s) 47
TfiI GAWTC 1 cut(s) 370
Tru1I TTAA 1 cut(s) 430
Tru9I TTAA 1 cut(s) 430
TscAI CASTG 2 cut(s) 162, 198
TseFI GTSAC 1 cut(s) 319
TseI GCWGC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 319
TspDTI ATGAA 1 cut(s) 366
TspGWI ACGGA 2 cut(s) 117, 402
TspRI CASTG 2 cut(s) 162, 198
XagI CCTNNNNNAGG 1 cut(s) 95
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.