RchiOBHm_Chr1g0364541

Protein of unknown function (DUF674)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0015730
Physical Location & Seq
Reverse (-)
55690519 .. 55690890
372 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 297 bp
ATGTCTTCCTCCTCCAAATCGTTAGAACCCCAAGTTGAAAAAACCGATCAAACCAATTTGAAACTCCACTTCCTCTATGACATCAAGAAACGCAAGATTGTTATGGCGGAGTCAAGTGCCAACTTGGTCGATATCTTATTTGGCTTTTTGGGTTTTCCAATTAGTTCTCTCTCTAAGTTAGAGGTAGGTGCAATGCCTCAAATTTGTAAAAGCTTAGCTAGTCTCGAAGGTGATATAATTCAACCTGGATTCAATAACAGTGAGTTTTTTGAATTGAAACCAACACGTGAGGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF674

Protein Analysis

98

Amino Acids

10.87

Weight (kDa)

5.77

Isoelectric Point (pI)

37.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF674 PF05056 12 - 76 1.3e-07 Protein of unknown function (DUF674)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AcsI RAATTY 1 cut(s) 201
AcvI CACGTG 1 cut(s) 287
AflIII ACRYGT 1 cut(s) 284
AgsI TTSAA 6 cut(s) 38, 61, 242, 253, 272, 277
AjnI CCWGG 1 cut(s) 244
AluBI AGCT 2 cut(s) 213, 218
AluI AGCT 2 cut(s) 213, 218
Alw26I GTCTC 1 cut(s) 227
ApoI RAATTY 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 242
BbrPI CACGTG 1 cut(s) 287
BciT130I CCWGG 1 cut(s) 246
BcoDI GTCTC 1 cut(s) 227
BfaI CTAG 1 cut(s) 219
BlpI GCTNAGC 1 cut(s) 214
Bme1390I CCNGG 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 246
Bpu1102I GCTNAGC 1 cut(s) 214
BsaAI YACGTR 1 cut(s) 287
Bse3DI GCAATG 1 cut(s) 198
BseBI CCWGG 1 cut(s) 246
BseMI GCAATG 1 cut(s) 198
BsmAI GTCTC 1 cut(s) 227
Bsp143I GATC 1 cut(s) 46
Bsp1720I GCTNAGC 1 cut(s) 214
BspACI CCGC 1 cut(s) 107
BsrDI GCAATG 1 cut(s) 198
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 246
Bst4CI ACNGT 1 cut(s) 260
BstBAI YACGTR 1 cut(s) 287
BstDEI CTNAG 2 cut(s) 174, 214
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 227
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 244
BtsIMutI CAGTG 1 cut(s) 265
CviJI RGCY 3 cut(s) 144, 213, 218
CviKI_1 RGCY 3 cut(s) 144, 213, 218
DdeI CTNAG 2 cut(s) 174, 214
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
EciI GGCGGA 1 cut(s) 122
Eco32I GATATC 1 cut(s) 133
Eco72I CACGTG 1 cut(s) 287
EcoRII CCWGG 1 cut(s) 244
EcoRV GATATC 1 cut(s) 133
FaiI YATR 3 cut(s) 78, 104, 236
FspBI CTAG 1 cut(s) 219
HindIII AAGCTT 1 cut(s) 211
HinfI GANTC 2 cut(s) 110, 249
HphI GGTGA 1 cut(s) 242
Hpy188III TCNNGA 2 cut(s) 85, 224
HpyAV CCTTC 1 cut(s) 221
HpyCH4III ACNGT 1 cut(s) 260
HpyCH4IV ACGT 1 cut(s) 286
HpyCH4V TGCA 1 cut(s) 191
HpyF3I CTNAG 2 cut(s) 174, 214
HpySE526I ACGT 1 cut(s) 286
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 2 cut(s) 231, 258
MaeI CTAG 1 cut(s) 219
MaeII ACGT 1 cut(s) 286
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MluCI AATT 5 cut(s) 55, 159, 201, 237, 272
MlyI GAGTC 1 cut(s) 119
MnlI CCTC 6 cut(s) 19, 22, 83, 175, 207, 283
MspR9I CCNGG 1 cut(s) 246
MvaI CCWGG 1 cut(s) 246
NdeII GATC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 249
PleI GAGTC 1 cut(s) 118
PmaCI CACGTG 1 cut(s) 287
PmlI CACGTG 1 cut(s) 287
PpsI GAGTC 1 cut(s) 118
Ppu21I YACGTR 1 cut(s) 287
Psp6I CCWGG 1 cut(s) 244
PspCI CACGTG 1 cut(s) 287
PspGI CCWGG 1 cut(s) 244
Sau3AI GATC 1 cut(s) 46
SchI GAGTC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 246
SetI ASST 7 cut(s) 186, 190, 215, 220, 232, 247, 289
SgeI CNNG 9 cut(s) 44, 97, 106, 126, 136, 231, 236, 257, 258
Sse9I AATT 5 cut(s) 55, 159, 201, 237, 272
SsiI CCGC 1 cut(s) 107
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 244
TaaI ACNGT 1 cut(s) 260
TaiI ACGT 1 cut(s) 289
TaqI TCGA 2 cut(s) 129, 225
TasI AATT 5 cut(s) 55, 159, 201, 237, 272
TfiI GAWTC 1 cut(s) 249
TscAI CASTG 1 cut(s) 265
TspRI CASTG 1 cut(s) 265
XapI RAATTY 1 cut(s) 201
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.