Rh1AG325000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
55863284 .. 55863944
661 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG325000.1

Sequence Viewer

Length: 189 bp
ATGTCTTCCTCCTCCAAATCGTTAGAACCCCAAGTTGAAAAAACCGATCAAACCAATTTGAAACTCCACTTCCTCTATGACATCAAGAAACGCAAGATTGTTATGGCGGAGTCAAGTGCCAACTTGGGTTCTGACGATTTAGAGGAGGAAGACATGATAGAACAGACAAATGGCCGTGGAGTCGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.97

Weight (kDa)

4.78

Isoelectric Point (pI)

55.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 107
AcoI YGGCCR 1 cut(s) 172
AgsI TTSAA 2 cut(s) 38, 61
AoxI GGCC 1 cut(s) 172
BbsI GAAGAC 1 cut(s) 156
BceAI ACGGC 1 cut(s) 159
BpiI GAAGAC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 175
BseRI GAGGAG 1 cut(s) 158
BshFI GGCC 1 cut(s) 174
BsnI GGCC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 107
BspANI GGCC 1 cut(s) 174
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 1 cut(s) 46
BstDSI CCRYGG 1 cut(s) 175
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstV2I GAAGAC 1 cut(s) 156
BsuRI GGCC 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 175
CviAII CATG 1 cut(s) 154
CviJI RGCY 1 cut(s) 174
CviKI_1 RGCY 1 cut(s) 174
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
EaeI YGGCCR 1 cut(s) 172
EciI GGCGGA 1 cut(s) 122
FaeI CATG 1 cut(s) 157
FaiI YATR 4 cut(s) 78, 104, 155, 187
FatI CATG 1 cut(s) 153
HaeIII GGCC 1 cut(s) 174
Hin1II CATG 1 cut(s) 157
HinfI GANTC 2 cut(s) 110, 180
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 1 cut(s) 85
Hsp92II CATG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 46
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 161
MluCI AATT 1 cut(s) 55
MlyI GAGTC 2 cut(s) 119, 189
MnlI CCTC 5 cut(s) 19, 22, 83, 136, 139
NdeII GATC 1 cut(s) 46
NlaIII CATG 1 cut(s) 157
PleI GAGTC 2 cut(s) 118, 188
PpsI GAGTC 2 cut(s) 118, 188
Sau3AI GATC 1 cut(s) 46
SchI GAGTC 2 cut(s) 119, 189
SgeI CNNG 6 cut(s) 44, 97, 106, 126, 136, 166
Sse9I AATT 1 cut(s) 55
SsiI CCGC 1 cut(s) 107
TasI AATT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.