Rh1AG331600

Protein of unknown function (DUF674)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0015730
Physical Location & Seq
Reverse (-)
56698236 .. 56698568
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG331600.1

Sequence Viewer

Length: 333 bp
ATGCCTTCCTCCTCCAAATCATCAGAACCCCAACTTGAAAAAACCGATCAAACCAATTTGAAACTCCACTTCCTCTACGACATCAAGAGACGCAAGATTTTTTTTACGGAGGCAAGCACCAACTTGGTCGATATCTTATTTGGCTTTTTGGGTTTTCCAATTAGTTCTCTCTCTAAGTTAGAGGTAGGTGCAATGCCTCAAATTTGTAAAAGCTTACCTAGTCTTGAAGGTGATATAATTCAACCTGGATTCAATAACTGTGAGTTTTTTGAATTGAAACCAACACGTGAGGGATGGCACAACAGAGTCCTCACTTTGTATTCCTGGAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF674

Protein Analysis

110

Amino Acids

12.66

Weight (kDa)

7.79

Isoelectric Point (pI)

47.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF674 PF05056 8 - 76 1e-06 Protein of unknown function (DUF674)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 201
AcvI CACGTG 1 cut(s) 287
AflIII ACRYGT 1 cut(s) 284
AgsI TTSAA 7 cut(s) 38, 61, 227, 242, 253, 272, 277
AjnI CCWGG 2 cut(s) 244, 323
AluBI AGCT 1 cut(s) 213
AluI AGCT 1 cut(s) 213
Alw26I GTCTC 1 cut(s) 82
ApoI RAATTY 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 242
BbrPI CACGTG 1 cut(s) 287
BccI CCATC 1 cut(s) 288
BciT130I CCWGG 2 cut(s) 246, 325
BcoDI GTCTC 1 cut(s) 82
BfaI CTAG 1 cut(s) 219
Bme1390I CCNGG 2 cut(s) 246, 325
BmrFI CCNGG 2 cut(s) 246, 325
BsaAI YACGTR 1 cut(s) 287
Bse3DI GCAATG 1 cut(s) 198
BseBI CCWGG 2 cut(s) 246, 325
BseGI GGATG 1 cut(s) 299
BseMI GCAATG 1 cut(s) 198
BsmAI GTCTC 1 cut(s) 82
BsmBI CGTCTC 1 cut(s) 82
Bsp143I GATC 1 cut(s) 46
BsrDI GCAATG 1 cut(s) 198
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 2 cut(s) 246, 325
Bst4CI ACNGT 1 cut(s) 260
BstBAI YACGTR 1 cut(s) 287
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 1 cut(s) 299
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 2 cut(s) 246, 325
BstSCI CCNGG 2 cut(s) 244, 323
BtsCI GGATG 1 cut(s) 299
Cac8I GCNNGC 1 cut(s) 115
CseI GACGC 1 cut(s) 99
CviJI RGCY 2 cut(s) 144, 213
CviKI_1 RGCY 2 cut(s) 144, 213
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eco32I GATATC 1 cut(s) 133
Eco72I CACGTG 1 cut(s) 287
EcoRII CCWGG 2 cut(s) 244, 323
EcoRV GATATC 1 cut(s) 133
Esp3I CGTCTC 1 cut(s) 82
FaiI YATR 1 cut(s) 236
FokI GGATG 1 cut(s) 306
FspBI CTAG 1 cut(s) 219
HgaI GACGC 1 cut(s) 99
HindIII AAGCTT 1 cut(s) 211
HinfI GANTC 2 cut(s) 249, 306
HphI GGTGA 1 cut(s) 242
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 2 cut(s) 85, 224
HpyAV CCTTC 2 cut(s) 15, 221
HpyCH4III ACNGT 1 cut(s) 260
HpyCH4IV ACGT 1 cut(s) 286
HpyCH4V TGCA 1 cut(s) 191
HpyF3I CTNAG 1 cut(s) 174
HpySE526I ACGT 1 cut(s) 286
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 3 cut(s) 231, 258, 310
MaeI CTAG 1 cut(s) 219
MaeII ACGT 1 cut(s) 286
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MluCI AATT 5 cut(s) 55, 159, 201, 237, 272
MlyI GAGTC 1 cut(s) 315
MnlI CCTC 8 cut(s) 19, 22, 83, 103, 175, 207, 283, 320
MspR9I CCNGG 2 cut(s) 246, 325
MvaI CCWGG 2 cut(s) 246, 325
NdeII GATC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 249
PfoI TCCNGGA 1 cut(s) 323
PleI GAGTC 1 cut(s) 314
PmaCI CACGTG 1 cut(s) 287
PmlI CACGTG 1 cut(s) 287
PpsI GAGTC 1 cut(s) 314
Ppu21I YACGTR 1 cut(s) 287
Psp6I CCWGG 2 cut(s) 244, 323
PspCI CACGTG 1 cut(s) 287
PspGI CCWGG 2 cut(s) 244, 323
Sau3AI GATC 1 cut(s) 46
SchI GAGTC 1 cut(s) 315
ScrFI CCNGG 2 cut(s) 246, 325
SetI ASST 7 cut(s) 186, 190, 215, 220, 232, 247, 289
Sse9I AATT 5 cut(s) 55, 159, 201, 237, 272
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 2 cut(s) 244, 323
TaaI ACNGT 1 cut(s) 260
TaiI ACGT 1 cut(s) 289
TaqI TCGA 1 cut(s) 129
TasI AATT 5 cut(s) 55, 159, 201, 237, 272
TfiI GAWTC 1 cut(s) 249
TspGWI ACGGA 1 cut(s) 122
XapI RAATTY 1 cut(s) 201
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.