RchiOBHm_Chr1g0382581

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
67378689 .. 67381004
2316 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 318 bp
ATGGTATTGATATGCTGGAATTCGACTCTTTTGATCAAACTTGTTCTCGACAGTGATACTACATTGCACCCTCTTGGCTCTCTGATTTCTTGCTACAGAACTTTGCTTGGGAGATTCAATTATGTTTCTCTTAATCATATTTATAGAGAGTGCAATATGGTTGCTGACTGCTTGGCCAAAAACAGTATTAACCATGACTATGGAGTGATTGAATTTGCCGACCCTCCTCCTCATGCTTTGCAGGCTTACTTGGATGATCTGGATTCTGTTGGTAGATCTCGAAAGATCAAAATTGGGCATGATTCTGATGCTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.78

Weight (kDa)

5.86

Isoelectric Point (pI)

36.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 11 - 61 2e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 2 cut(s) 19, 212
AgsI TTSAA 2 cut(s) 118, 212
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 2 cut(s) 19, 212
BalI TGGCCA 1 cut(s) 176
BclI TGATCA 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 94
BglII AGATCT 1 cut(s) 275
BmsI GCATC 1 cut(s) 298
Bse3DI GCAATG 1 cut(s) 62
BseGI GGATG 1 cut(s) 259
BseMI GCAATG 1 cut(s) 62
BseRI GAGGAG 2 cut(s) 216, 219
BshFI GGCC 1 cut(s) 176
BsnI GGCC 1 cut(s) 176
Bsp143I GATC 4 cut(s) 33, 256, 275, 285
BspANI GGCC 1 cut(s) 176
BsrDI GCAATG 1 cut(s) 62
BssMI GATC 4 cut(s) 33, 256, 275, 285
Bst4CI ACNGT 2 cut(s) 53, 185
BstC8I GCNNGC 1 cut(s) 243
BstF5I GGATG 1 cut(s) 259
BstKTI GATC 4 cut(s) 36, 259, 278, 288
BstMBI GATC 4 cut(s) 33, 256, 275, 285
BstMWI GCNNNNNNNGC 1 cut(s) 242
BstSFI CTRYAG 1 cut(s) 94
BstX2I RGATCY 1 cut(s) 275
BstXI CCANNNNNNTGG 1 cut(s) 200
BstYI RGATCY 1 cut(s) 275
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 259
BtsIMutI CAGTG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 243
CviAII CATG 3 cut(s) 194, 233, 299
CviJI RGCY 3 cut(s) 78, 176, 245
CviKI_1 RGCY 3 cut(s) 78, 176, 245
DpnI GATC 4 cut(s) 35, 258, 277, 287
DpnII GATC 4 cut(s) 33, 256, 275, 285
EaeI YGGCCR 1 cut(s) 174
EcoRI GAATTC 1 cut(s) 19
FaeI CATG 3 cut(s) 197, 236, 302
FaiI YATR 9 cut(s) 13, 123, 138, 144, 158, 195, 201, 234, 300
FatI CATG 3 cut(s) 193, 232, 298
FbaI TGATCA 1 cut(s) 33
FokI GGATG 1 cut(s) 266
HaeIII GGCC 1 cut(s) 176
Hin1II CATG 3 cut(s) 197, 236, 302
HinfI GANTC 4 cut(s) 25, 114, 263, 302
Hpy188I TCNGA 2 cut(s) 84, 307
Hpy188III TCNNGA 3 cut(s) 47, 260, 279
HpyCH4III ACNGT 2 cut(s) 53, 185
HpyCH4V TGCA 3 cut(s) 67, 153, 241
HpyF10VI GCNNNNNNNGC 1 cut(s) 242
Hsp92II CATG 3 cut(s) 197, 236, 302
Ksp22I TGATCA 1 cut(s) 33
Kzo9I GATC 4 cut(s) 33, 256, 275, 285
LpnPI CCDG 2 cut(s) 227, 245
LweI GCATC 1 cut(s) 298
MalI GATC 4 cut(s) 35, 258, 277, 287
MboI GATC 4 cut(s) 33, 256, 275, 285
MflI RGATCY 1 cut(s) 275
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 4 cut(s) 19, 118, 212, 291
MluNI TGGCCA 1 cut(s) 176
MlyI GAGTC 1 cut(s) 19
MnlI CCTC 4 cut(s) 81, 234, 237, 240
Mox20I TGGCCA 1 cut(s) 176
MscI TGGCCA 1 cut(s) 176
MseI TTAA 2 cut(s) 132, 189
MslI CAYNNNNRTG 1 cut(s) 198
Msp20I TGGCCA 1 cut(s) 176
MwoI GCNNNNNNNGC 1 cut(s) 242
NdeII GATC 4 cut(s) 33, 256, 275, 285
NlaIII CATG 3 cut(s) 197, 236, 302
PfeI GAWTC 3 cut(s) 114, 263, 302
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PsuI RGATCY 1 cut(s) 275
RseI CAYNNNNRTG 1 cut(s) 198
SaqAI TTAA 2 cut(s) 132, 189
Sau3AI GATC 4 cut(s) 33, 256, 275, 285
SchI GAGTC 1 cut(s) 19
SfaNI GCATC 1 cut(s) 298
SfcI CTRYAG 1 cut(s) 94
SmiMI CAYNNNNRTG 1 cut(s) 198
Sse9I AATT 4 cut(s) 19, 118, 212, 291
TaaI ACNGT 2 cut(s) 53, 185
TaqI TCGA 3 cut(s) 23, 48, 280
TasI AATT 4 cut(s) 19, 118, 212, 291
TfiI GAWTC 3 cut(s) 114, 263, 302
Tru1I TTAA 2 cut(s) 132, 189
Tru9I TTAA 2 cut(s) 132, 189
TscAI CASTG 1 cut(s) 58
TspRI CASTG 1 cut(s) 58
XapI RAATTY 2 cut(s) 19, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.