Rroxscaffold_7G00160710

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
3651895 .. 3653076
1182 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00160710.1

Sequence Viewer

Length: 387 bp
ATGCTGGGAATCTGTGGTGCTCTACCTTTGTTTTCATATGCTAGTTCATTTGGAAATGGAGGAACAAGCATATATTTGAGGCTCACTTTCAAAAACCCAATTATCCCGTTAATCTCTGAGACTGATGTTACTCTTCACCCCATGGGCTCACTTATTTGCTGCTGCAAAAATCTGATTAGAAATTTTCAATGCTTCTCCACAAGGCACATTTACAGAGAATGTAGCATGGTTGCGGACTGCCTTGCTAAGCAGAGCATCAATCATGCTTATGGGTTAATCGAATTTGATAGCCCTCCTATCCATGCCTCTCCTGCTTATCTTGATGATCTTGATGGAGTTACTCGGCAAAGACGAATCTCTGTTAGGCCTGATAATAGGCCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.29

Weight (kDa)

8.53

Isoelectric Point (pI)

48.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 233
AcsI RAATTY 2 cut(s) 181, 281
AgsI TTSAA 2 cut(s) 91, 188
Alw21I GWGCWC 1 cut(s) 22
Alw26I GTCTC 1 cut(s) 113
AoxI GGCC 2 cut(s) 365, 377
ApeKI GCWGC 2 cut(s) 159, 162
ApoI RAATTY 2 cut(s) 181, 281
AsuHPI GGTGA 1 cut(s) 128
BanII GRGCYC 1 cut(s) 149
Bbv12I GWGCWC 1 cut(s) 22
BbvI GCAGC 2 cut(s) 146, 149
BccI CCATC 1 cut(s) 326
BcoDI GTCTC 1 cut(s) 113
BfaI CTAG 1 cut(s) 42
BisI GCNGC 2 cut(s) 160, 163
BlpI GCTNAGC 1 cut(s) 246
BlsI GCNGC 2 cut(s) 161, 164
BmsI GCATC 1 cut(s) 264
Bpu1102I GCTNAGC 1 cut(s) 246
BsaJI CCNNGG 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 108
BseXI GCAGC 2 cut(s) 146, 149
BseYI CCCAGC 1 cut(s) 4
BshFI GGCC 2 cut(s) 367, 379
BsiHKAI GWGCWC 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 113
BsnI GGCC 2 cut(s) 367, 379
Bsp1286I GDGCHC 2 cut(s) 22, 149
Bsp143I GATC 1 cut(s) 325
Bsp1720I GCTNAGC 1 cut(s) 246
Bsp19I CCATGG 1 cut(s) 141
BspACI CCGC 1 cut(s) 233
BspANI GGCC 2 cut(s) 367, 379
BspCNI CTCAG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 1 cut(s) 325
BssT1I CCWWGG 1 cut(s) 141
Bst6I CTCTTC 1 cut(s) 138
BstDEI CTNAG 2 cut(s) 117, 246
BstDSI CCRYGG 1 cut(s) 141
BstKTI GATC 1 cut(s) 328
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 1 cut(s) 325
BstMWI GCNNNNNNNGC 1 cut(s) 311
BstV1I GCAGC 2 cut(s) 146, 149
BsuRI GGCC 2 cut(s) 367, 379
BtgI CCRYGG 1 cut(s) 141
CviAII CATG 4 cut(s) 142, 226, 263, 302
CviJI RGCY 5 cut(s) 82, 147, 291, 367, 379
CviKI_1 RGCY 5 cut(s) 82, 147, 291, 367, 379
DdeI CTNAG 2 cut(s) 117, 246
DpnI GATC 1 cut(s) 327
DpnII GATC 1 cut(s) 325
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco130I CCWWGG 1 cut(s) 141
Eco147I AGGCCT 1 cut(s) 367
Eco24I GRGCYC 1 cut(s) 149
EcoT14I CCWWGG 1 cut(s) 141
EcoT38I GRGCYC 1 cut(s) 149
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 4 cut(s) 145, 229, 266, 305
FaiI YATR 9 cut(s) 37, 39, 71, 73, 143, 227, 264, 270, 303
FatI CATG 4 cut(s) 141, 225, 262, 301
FauNDI CATATG 1 cut(s) 37
Fnu4HI GCNGC 2 cut(s) 160, 163
FriOI GRGCYC 1 cut(s) 149
Fsp4HI GCNGC 2 cut(s) 160, 163
FspBI CTAG 1 cut(s) 42
GluI GCNGC 2 cut(s) 160, 163
GsaI CCCAGC 1 cut(s) 8
HaeIII GGCC 2 cut(s) 367, 379
Hin1II CATG 4 cut(s) 145, 229, 266, 305
HinfI GANTC 2 cut(s) 9, 354
HphI GGTGA 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 118, 174
Hpy188III TCNNGA 2 cut(s) 320, 329
HpyCH4V TGCA 1 cut(s) 165
HpyF10VI GCNNNNNNNGC 1 cut(s) 311
HpyF3I CTNAG 2 cut(s) 117, 246
Hsp92II CATG 4 cut(s) 145, 229, 266, 305
Kzo9I GATC 1 cut(s) 325
LpnPI CCDG 2 cut(s) 324, 381
Lsp1109I GCAGC 2 cut(s) 146, 149
LweI GCATC 1 cut(s) 264
MaeI CTAG 1 cut(s) 42
MaeIII GTNAC 2 cut(s) 127, 337
MalI GATC 1 cut(s) 327
MboI GATC 1 cut(s) 325
MboII GAAGA 1 cut(s) 125
MhlI GDGCHC 2 cut(s) 22, 149
MluCI AATT 3 cut(s) 99, 181, 281
MnlI CCTC 4 cut(s) 53, 72, 303, 316
MseI TTAA 2 cut(s) 110, 275
MslI CAYNNNNRTG 1 cut(s) 267
MwoI GCNNNNNNNGC 1 cut(s) 311
NcoI CCATGG 1 cut(s) 141
NdeI CATATG 1 cut(s) 37
NdeII GATC 1 cut(s) 325
NlaIII CATG 4 cut(s) 145, 229, 266, 305
NmeAIII GCCGAG 1 cut(s) 322
PceI AGGCCT 1 cut(s) 367
PcsI WCGNNNNNNNCGW 1 cut(s) 349
PfeI GAWTC 2 cut(s) 9, 354
PkrI GCNGC 2 cut(s) 161, 164
PspFI CCCAGC 1 cut(s) 4
RseI CAYNNNNRTG 1 cut(s) 267
SaqAI TTAA 2 cut(s) 110, 275
SatI GCNGC 2 cut(s) 160, 163
Sau3AI GATC 1 cut(s) 325
SduI GDGCHC 2 cut(s) 22, 149
SetI ASST 1 cut(s) 28
SfaNI GCATC 1 cut(s) 264
SmiMI CAYNNNNRTG 1 cut(s) 267
Sse9I AATT 3 cut(s) 99, 181, 281
SseBI AGGCCT 1 cut(s) 367
SsiI CCGC 1 cut(s) 233
SspMI CTAG 1 cut(s) 42
StuI AGGCCT 1 cut(s) 367
StyI CCWWGG 1 cut(s) 141
TaqI TCGA 1 cut(s) 279
TasI AATT 3 cut(s) 99, 181, 281
TfiI GAWTC 2 cut(s) 9, 354
Tru1I TTAA 2 cut(s) 110, 275
Tru9I TTAA 2 cut(s) 110, 275
TseI GCWGC 2 cut(s) 159, 162
TspDTI ATGAA 2 cut(s) 24, 36
XapI RAATTY 2 cut(s) 181, 281
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.