Rroxscaffold_5G00369740

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
51540948 .. 51541603
656 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00369740.1

Sequence Viewer

Length: 192 bp
ATGTGTTTTGATACATCGGTTCTGAGGGATGAAAGACACCCGAAACGGGGACCAAACCAATACCAGCTTTCTCTAGTCGGTTTCTATATGGAACCAGAAATTCCAGATCAAGAACCGTGCCGAATCGACCATTTCGGGTCTGTTTCTCGGGTTTTCAGTTCAAAAATCCCAGCCCTCAAACATGTGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.33

Weight (kDa)

6.89

Isoelectric Point (pI)

43.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 99
AfiI CCNNNNNNNGG 2 cut(s) 46, 47
AflIII ACRYGT 1 cut(s) 181
AgsI TTSAA 1 cut(s) 162
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
Alw21I GWGCWC 1 cut(s) 189
Alw44I GTGCAC 1 cut(s) 185
Ama87I CYCGRG 1 cut(s) 147
ApaLI GTGCAC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 50
AvaI CYCGRG 1 cut(s) 147
AvaII GGWCC 1 cut(s) 50
BaeGI GKGCMC 1 cut(s) 189
BaeI ACNNNNGTAYC 1 cut(s) 36
Bbv12I GWGCWC 1 cut(s) 189
BfaI CTAG 2 cut(s) 74, 190
Bme18I GGWCC 1 cut(s) 50
BmeT110I CYCGRG 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 50
BmiI GGNNCC 2 cut(s) 51, 93
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 47
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 2 cut(s) 46, 47
BseMII CTCAG 1 cut(s) 14
BseSI GKGCMC 1 cut(s) 189
BseYI CCCAGC 1 cut(s) 169
BsiHKAI GWGCWC 1 cut(s) 189
BsiHKCI CYCGRG 1 cut(s) 147
BslFI GGGAC 1 cut(s) 63
BslI CCNNNNNNNGG 2 cut(s) 46, 47
BsmFI GGGAC 1 cut(s) 63
BsoBI CYCGRG 1 cut(s) 147
Bsp1286I GDGCHC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 106
BspCNI CTCAG 1 cut(s) 15
BspLI GGNNCC 2 cut(s) 51, 93
BssMI GATC 1 cut(s) 106
Bst4CI ACNGT 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 109
BstMBI GATC 1 cut(s) 106
BstNSI RCATGY 1 cut(s) 185
BstSLI GKGCMC 1 cut(s) 189
BtsCI GGATG 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 50
CviAII CATG 1 cut(s) 182
CviJI RGCY 2 cut(s) 67, 173
CviKI_1 RGCY 2 cut(s) 67, 173
DdeI CTNAG 1 cut(s) 23
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eco47I GGWCC 1 cut(s) 50
Eco88I CYCGRG 1 cut(s) 147
FaeI CATG 1 cut(s) 185
FaiI YATR 3 cut(s) 87, 89, 183
FaqI GGGAC 1 cut(s) 63
FatI CATG 1 cut(s) 181
FokI GGATG 1 cut(s) 41
FspBI CTAG 2 cut(s) 74, 190
GsaI CCCAGC 1 cut(s) 173
Hin1II CATG 1 cut(s) 185
HinfI GANTC 1 cut(s) 123
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 2 cut(s) 104, 110
Hpy8I GTNNAC 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 187
HpyF3I CTNAG 1 cut(s) 23
Hsp92II CATG 1 cut(s) 185
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 4 cut(s) 77, 108, 117, 183
MaeI CTAG 2 cut(s) 74, 190
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MhlI GDGCHC 1 cut(s) 189
MluCI AATT 1 cut(s) 99
MnlI CCTC 2 cut(s) 18, 185
NdeII GATC 1 cut(s) 106
NlaIII CATG 1 cut(s) 185
NlaIV GGNNCC 2 cut(s) 51, 93
NspI RCATGY 1 cut(s) 185
PciI ACATGT 1 cut(s) 181
PfeI GAWTC 1 cut(s) 123
PscI ACATGT 1 cut(s) 181
PspFI CCCAGC 1 cut(s) 169
PspN4I GGNNCC 2 cut(s) 51, 93
PspPI GGNCC 1 cut(s) 50
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 50
SduI GDGCHC 1 cut(s) 189
SetI ASST 1 cut(s) 69
SinI GGWCC 1 cut(s) 50
Sse9I AATT 1 cut(s) 99
SspMI CTAG 2 cut(s) 74, 190
TaaI ACNGT 1 cut(s) 117
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 99
TfiI GAWTC 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 45
VneI GTGCAC 1 cut(s) 185
VpaK11BI GGWCC 1 cut(s) 50
XapI RAATTY 1 cut(s) 99
XceI RCATGY 1 cut(s) 185
XspI CTAG 2 cut(s) 74, 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.