RchiOBHm_Chr1g0326611

SPX and EXS domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
15125124 .. 15125478
355 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55622

Sequence Viewer

Length: 141 bp
ATGATATGGGGATTTAATTGTTGCAAGATTGGATGGGATTCTGCCATGAGAATGAGTGCGAATTTGCGTAATTTATTCTTATATGAGGCCTTTTTGTATTATAACCCACCTCTCATCATGACTTTGATGGTTTGGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

5.54

Weight (kDa)

7.79

Isoelectric Point (pI)

33.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AcsI RAATTY 1 cut(s) 61
AoxI GGCC 1 cut(s) 87
ApoI RAATTY 1 cut(s) 61
BccI CCATC 2 cut(s) 27, 121
BseGI GGATG 1 cut(s) 38
BshFI GGCC 1 cut(s) 89
BsnI GGCC 1 cut(s) 89
BspANI GGCC 1 cut(s) 89
BspHI TCATGA 1 cut(s) 117
BstF5I GGATG 1 cut(s) 38
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 1 cut(s) 38
CciI TCATGA 1 cut(s) 117
CviAII CATG 2 cut(s) 46, 118
CviJI RGCY 2 cut(s) 89, 136
CviKI_1 RGCY 2 cut(s) 89, 136
Eco147I AGGCCT 1 cut(s) 89
FaeI CATG 2 cut(s) 49, 121
FaiI YATR 6 cut(s) 7, 47, 82, 84, 102, 119
FatI CATG 2 cut(s) 45, 117
FokI GGATG 1 cut(s) 45
HaeIII GGCC 1 cut(s) 89
Hin1II CATG 2 cut(s) 49, 121
HinfI GANTC 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 24
Hsp92II CATG 2 cut(s) 49, 121
MluCI AATT 3 cut(s) 16, 61, 70
MnlI CCTC 2 cut(s) 79, 120
MseI TTAA 1 cut(s) 15
MslI CAYNNNNRTG 1 cut(s) 50
NlaIII CATG 2 cut(s) 49, 121
PagI TCATGA 1 cut(s) 117
PceI AGGCCT 1 cut(s) 89
PfeI GAWTC 1 cut(s) 38
PsiI TTATAA 1 cut(s) 102
RseI CAYNNNNRTG 1 cut(s) 50
SaqAI TTAA 1 cut(s) 15
SetI ASST 1 cut(s) 112
SgeI CNNG 3 cut(s) 37, 58, 130
SmiMI CAYNNNNRTG 1 cut(s) 50
Sse9I AATT 3 cut(s) 16, 61, 70
SseBI AGGCCT 1 cut(s) 89
StuI AGGCCT 1 cut(s) 89
TasI AATT 3 cut(s) 16, 61, 70
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
XapI RAATTY 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.