RchiOBHm_Chr2g0127371

SPX and EXS domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
42212874 .. 42213379
506 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49925

Sequence Viewer

Length: 273 bp
ATGATATGGGGATTTAATTGTTGCAAGATTGGATGGGATTCTGCCATGAGAATGAGTGCGAATTTGCGTAATTTATTCTTATATGAGGCCTTTTTGTATTATAACCCACCTCTCATCATGGGAGTGAACTTATGGGTATTTTTGCAGGCCAACATTGGCAATGCAAAAATATTTGATCTTGATCAAAATCATCTCACTCACAAAGAAGTATGGAAGATATTGATGGTTCATTCGATTTTTCATTGTCCTCCCCTCCCCCCATCGTCTCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.5

Weight (kDa)

7.77

Isoelectric Point (pI)

47.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AcsI RAATTY 1 cut(s) 61
AoxI GGCC 2 cut(s) 87, 147
ApoI RAATTY 1 cut(s) 61
BccI CCATC 3 cut(s) 27, 217, 268
BclI TGATCA 1 cut(s) 181
BsaBI GATNNNNATC 2 cut(s) 180, 186
Bse3DI GCAATG 1 cut(s) 166
Bse8I GATNNNNATC 2 cut(s) 180, 186
BseGI GGATG 1 cut(s) 38
BseJI GATNNNNATC 2 cut(s) 180, 186
BseMI GCAATG 1 cut(s) 166
BshFI GGCC 2 cut(s) 89, 149
BsnI GGCC 2 cut(s) 89, 149
Bsp143I GATC 2 cut(s) 175, 181
BspANI GGCC 2 cut(s) 89, 149
BsrDI GCAATG 1 cut(s) 166
BssMI GATC 2 cut(s) 175, 181
BstC8I GCNNGC 1 cut(s) 147
BstF5I GGATG 1 cut(s) 38
BstKTI GATC 2 cut(s) 178, 184
BstMBI GATC 2 cut(s) 175, 181
BsuRI GGCC 2 cut(s) 89, 149
BtsCI GGATG 1 cut(s) 38
Cac8I GCNNGC 1 cut(s) 147
CviAII CATG 2 cut(s) 46, 118
CviJI RGCY 2 cut(s) 89, 149
CviKI_1 RGCY 2 cut(s) 89, 149
DpnI GATC 2 cut(s) 177, 183
DpnII GATC 2 cut(s) 175, 181
Eco147I AGGCCT 1 cut(s) 89
FaeI CATG 2 cut(s) 49, 121
FaiI YATR 8 cut(s) 7, 47, 82, 84, 102, 119, 133, 211
FatI CATG 2 cut(s) 45, 117
FbaI TGATCA 1 cut(s) 181
FokI GGATG 1 cut(s) 45
HaeIII GGCC 2 cut(s) 89, 149
Hin1II CATG 2 cut(s) 49, 121
HinfI GANTC 1 cut(s) 38
Hpy166II GTNNAC 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4V TGCA 3 cut(s) 24, 145, 164
Hsp92II CATG 2 cut(s) 49, 121
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 2 cut(s) 175, 181
LpnPI CCDG 1 cut(s) 131
MalI GATC 2 cut(s) 177, 183
MboI GATC 2 cut(s) 175, 181
MboII GAAGA 1 cut(s) 226
MluCI AATT 3 cut(s) 16, 61, 70
MnlI CCTC 4 cut(s) 79, 120, 258, 263
MseI TTAA 1 cut(s) 15
MslI CAYNNNNRTG 2 cut(s) 50, 122
NdeII GATC 2 cut(s) 175, 181
NlaIII CATG 2 cut(s) 49, 121
PceI AGGCCT 1 cut(s) 89
PfeI GAWTC 1 cut(s) 38
PsiI TTATAA 1 cut(s) 102
RseI CAYNNNNRTG 2 cut(s) 50, 122
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 2 cut(s) 175, 181
SetI ASST 1 cut(s) 112
SgeI CNNG 5 cut(s) 37, 58, 130, 158, 191
SmiMI CAYNNNNRTG 2 cut(s) 50, 122
Sse9I AATT 3 cut(s) 16, 61, 70
SseBI AGGCCT 1 cut(s) 89
SspI AATATT 1 cut(s) 171
StuI AGGCCT 1 cut(s) 89
TaqI TCGA 1 cut(s) 233
TasI AATT 3 cut(s) 16, 61, 70
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 218, 230
XapI RAATTY 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.