Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002464.1

Orthogroup ID

OG0015825

Physical Location & Seq

Genomic Coordinates Reverse (-)

18592 .. 20099

Gene Structure 1508 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002464.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 423 bp

atgaagagtccactctcacagattcataccgctgcagtgtttccatctccagtttttctatggagggttaaggtactacttttcatgatatggggattcagttgttgcaagattggatgggattctgccatgagaatgagtgcagatttgcgtaatttattcttatatgaggcctttttgtattataacccacccctcctcatgactttgatggtttggctttggggagtgaacttatgggttttttcgcaggccaacattggctatgcaaaaatatttgatcttgatcaaaatcatctcactcacaaagaagtatggaagtgtagcacttggatgaccatcattgtccctactagcatgacagcatatctttacctttactcacacggaaaattattattggctgcattactaccagtgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EXS

Protein Analysis

140

Amino Acids

16.3

Weight (kDa)

9.05

Isoelectric Point (pI)

43.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015825)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35730
prunus_persica	Prupe.2G153500_v2.0.a1 Prupe.2G153500_v2.0.a1 Prupe.2G153500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0326611 RchiOBHm_Chr1g0352051 RchiOBHm_Chr2g0127371
rosa_laevigata	RLG00000028364
rosa_multiflora	Rmu_sc0002464.1_g000004
rosa_rugosa	Rorug01G0223700
rosa_samantha	Rh1AG238200 Rh1BG208600 Rh1CG222600 Rh1DG235000
rosa_wichuraiana	Rw1G020690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	186
AciI	CCGC	1 cut(s)	30
AfaI	GTAC	1 cut(s)	75
AoxI	GGCC	2 cut(s)	171, 252
ApeKI	GCWGC	2 cut(s)	32, 404
BbvI	GCAGC	2 cut(s)	19, 391
BccI	CCATC	4 cut(s)	52, 111, 205, 347
BclI	TGATCA	1 cut(s)	286
BfaI	CTAG	1 cut(s)	354
BfmI	CTRYAG	1 cut(s)	33
BisI	GCNGC	2 cut(s)	33, 405
BlsI	GCNGC	2 cut(s)	34, 406
BpmI	CTGGAG	1 cut(s)	33
BsaBI	GATNNNNATC	3 cut(s)	285, 291, 338
Bse1I	ACTGG	2 cut(s)	50, 416
Bse8I	GATNNNNATC	3 cut(s)	285, 291, 338
BseGI	GGATG	2 cut(s)	122, 339
BseJI	GATNNNNATC	3 cut(s)	285, 291, 338
BseNI	ACTGG	2 cut(s)	50, 416
BseRI	GAGGAG	1 cut(s)	188
BseXI	GCAGC	2 cut(s)	19, 391
BsgI	GTGCAG	1 cut(s)	162
BshFI	GGCC	2 cut(s)	173, 254
BslFI	GGGAC	1 cut(s)	332
BsmFI	GGGAC	1 cut(s)	332
BsnI	GGCC	2 cut(s)	173, 254
Bsp143I	GATC	2 cut(s)	280, 286
BspACI	CCGC	1 cut(s)	30
BspANI	GGCC	2 cut(s)	173, 254
BspHI	TCATGA	2 cut(s)	84, 201
BspMAI	CTGCAG	1 cut(s)	37
BsrI	ACTGG	2 cut(s)	50, 416
BssMI	GATC	2 cut(s)	280, 286
BstC8I	GCNNGC	1 cut(s)	252
BstF5I	GGATG	2 cut(s)	122, 339
BstKTI	GATC	2 cut(s)	283, 289
BstMBI	GATC	2 cut(s)	280, 286
BstSFI	CTRYAG	1 cut(s)	33
BstV1I	GCAGC	2 cut(s)	19, 391
BsuRI	GGCC	2 cut(s)	173, 254
BtsCI	GGATG	2 cut(s)	122, 339
BtsI	GCAGTG	1 cut(s)	42
BtsIMutI	CAGTG	2 cut(s)	42, 423
Cac8I	GCNNGC	1 cut(s)	252
CciI	TCATGA	2 cut(s)	84, 201
Csp6I	GTAC	1 cut(s)	74
CviAII	CATG	4 cut(s)	85, 130, 202, 358
CviJI	RGCY	5 cut(s)	173, 220, 254, 264, 404
CviKI_1	RGCY	5 cut(s)	173, 220, 254, 264, 404
CviQI	GTAC	1 cut(s)	74
DpnI	GATC	2 cut(s)	282, 288
DpnII	GATC	2 cut(s)	280, 286
Eco147I	AGGCCT	1 cut(s)	173
FaeI	CATG	4 cut(s)	88, 133, 205, 361
FaqI	GGGAC	1 cut(s)	332
FatI	CATG	4 cut(s)	84, 129, 201, 357
FbaI	TGATCA	1 cut(s)	286
Fnu4HI	GCNGC	2 cut(s)	33, 405
FokI	GGATG	2 cut(s)	129, 346
Fsp4HI	GCNGC	2 cut(s)	33, 405
FspBI	CTAG	1 cut(s)	354
GluI	GCNGC	2 cut(s)	33, 405
GsuI	CTGGAG	1 cut(s)	33
HaeIII	GGCC	2 cut(s)	173, 254
Hin1II	CATG	4 cut(s)	88, 133, 205, 361
HinfI	GANTC	4 cut(s)	7, 22, 96, 122
Hpy166II	GTNNAC	2 cut(s)	11, 232
Hpy188III	TCNNGA	3 cut(s)	85, 202, 284
Hpy8I	GTNNAC	2 cut(s)	11, 232
HpyCH4V	TGCA	5 cut(s)	35, 108, 143, 269, 407
Hsp92II	CATG	4 cut(s)	88, 133, 205, 361
Ksp22I	TGATCA	1 cut(s)	286
Kzo9I	GATC	2 cut(s)	280, 286
LpnPI	CCDG	2 cut(s)	63, 236
Lsp1109I	GCAGC	2 cut(s)	19, 391
MaeI	CTAG	1 cut(s)	354
MalI	GATC	2 cut(s)	282, 288
MboI	GATC	2 cut(s)	280, 286
MboII	GAAGA	1 cut(s)	16
MluCI	AATT	2 cut(s)	154, 392
MlyI	GAGTC	1 cut(s)	16
MnlI	CCTC	4 cut(s)	57, 163, 206, 209
MseI	TTAA	1 cut(s)	69
MslI	CAYNNNNRTG	2 cut(s)	134, 332
MspA1I	CMGCKG	1 cut(s)	32
NdeII	GATC	2 cut(s)	280, 286
NlaIII	CATG	4 cut(s)	88, 133, 205, 361
PagI	TCATGA	2 cut(s)	84, 201
PceI	AGGCCT	1 cut(s)	173
PfeI	GAWTC	3 cut(s)	22, 96, 122
PkrI	GCNGC	2 cut(s)	34, 406
PleI	GAGTC	1 cut(s)	15
PpsI	GAGTC	1 cut(s)	15
PsiI	TTATAA	1 cut(s)	186
PstI	CTGCAG	1 cut(s)	37
RsaI	GTAC	1 cut(s)	75
RsaNI	GTAC	1 cut(s)	74
RseI	CAYNNNNRTG	2 cut(s)	134, 332
SaqAI	TTAA	1 cut(s)	69
SatI	GCNGC	2 cut(s)	33, 405
Sau3AI	GATC	2 cut(s)	280, 286
SchI	GAGTC	1 cut(s)	16
SetI	ASST	2 cut(s)	75, 378
SfcI	CTRYAG	1 cut(s)	33
SmiMI	CAYNNNNRTG	2 cut(s)	134, 332
Sse9I	AATT	2 cut(s)	154, 392
SseBI	AGGCCT	1 cut(s)	173
SsiI	CCGC	1 cut(s)	30
SspI	AATATT	1 cut(s)	276
SspMI	CTAG	1 cut(s)	354
StuI	AGGCCT	1 cut(s)	173
TasI	AATT	2 cut(s)	154, 392
TfiI	GAWTC	3 cut(s)	22, 96, 122
Tru1I	TTAA	1 cut(s)	69
Tru9I	TTAA	1 cut(s)	69
TscAI	CASTG	2 cut(s)	42, 423
TseI	GCWGC	2 cut(s)	32, 404
TspDTI	ATGAA	3 cut(s)	14, 17, 73
TspGWI	ACGGA	1 cut(s)	402
TspRI	CASTG	2 cut(s)	42, 423
XcmI	CCANNNNNNNNNTGG	1 cut(s)	57
XspI	CTAG	1 cut(s)	354

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.