RchiOBHm_Chr2g0097791

Zinc finger CCCH domain-containing protein 15 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
10330090 .. 10330257
168 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47263

Sequence Viewer

Length: 168 bp
ATGACCCAATTCCTCACCTGGAAACGCCAGAAGGATGATGATGCATCTGCCACAAGAGCTGAAGCAGCGAGGAAACAGGCAAATGACATAACTGTTGGGACAGTGCAAATGAATGGTCGAGAGCTTTTCACACATCAACCTTGGATTTTTGATAACACTCTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.42

Weight (kDa)

6.53

Isoelectric Point (pI)

15.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 81
AjnI CCWGG 1 cut(s) 17
AluBI AGCT 2 cut(s) 59, 124
AluI AGCT 2 cut(s) 59, 124
ApeKI GCWGC 1 cut(s) 65
ArsI GACNNNNNNTTYG 2 cut(s) 100, 132
AsuHPI GGTGA 1 cut(s) 7
BbvI GCAGC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 19
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 19
BmsI GCATC 2 cut(s) 31, 53
BsaJI CCNNGG 1 cut(s) 140
BseBI CCWGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 40
BseXI GCAGC 1 cut(s) 77
BslFI GGGAC 1 cut(s) 112
BsmFI GGGAC 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 140
BssT1I CCWWGG 1 cut(s) 140
Bst2UI CCWGG 1 cut(s) 19
Bst4CI ACNGT 2 cut(s) 94, 103
BstF5I GGATG 1 cut(s) 40
BstMWI GCNNNNNNNGC 2 cut(s) 56, 65
BstNI CCWGG 1 cut(s) 19
BstSCI CCNGG 1 cut(s) 17
BstV1I GCAGC 1 cut(s) 77
BtsCI GGATG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 108
CviJI RGCY 2 cut(s) 59, 124
CviKI_1 RGCY 2 cut(s) 59, 124
Eco130I CCWWGG 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 17
EcoT14I CCWWGG 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 46
ErhI CCWWGG 1 cut(s) 140
FaiI YATR 1 cut(s) 89
FaqI GGGAC 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 66
GluI GCNGC 1 cut(s) 66
HphI GGTGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 25
HpyCH4III ACNGT 2 cut(s) 94, 103
HpyCH4V TGCA 2 cut(s) 44, 106
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 65
LpnPI CCDG 4 cut(s) 4, 31, 41, 62
Lsp1109I GCAGC 1 cut(s) 77
LweI GCATC 2 cut(s) 31, 53
MluCI AATT 1 cut(s) 8
MnlI CCTC 2 cut(s) 23, 63
Mph1103I ATGCAT 1 cut(s) 46
MspR9I CCNGG 1 cut(s) 19
MvaI CCWGG 1 cut(s) 19
MwoI GCNNNNNNNGC 2 cut(s) 56, 65
NsiI ATGCAT 1 cut(s) 46
PkrI GCNGC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 17
PspGI CCWGG 1 cut(s) 17
SatI GCNGC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 19
SetI ASST 4 cut(s) 20, 61, 126, 142
SfaNI GCATC 2 cut(s) 31, 53
SgeI CNNG 8 cut(s) 30, 31, 40, 66, 81, 89, 131, 153
Sse9I AATT 1 cut(s) 8
StyD4I CCNGG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 140
TaaI ACNGT 2 cut(s) 94, 103
TaqI TCGA 1 cut(s) 118
TasI AATT 1 cut(s) 8
TscAI CASTG 1 cut(s) 108
TseI GCWGC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 125
TspRI CASTG 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.