RchiOBHm_Chr2g0123531

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
36714035 .. 36717873
3839 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49582

Sequence Viewer

Length: 207 bp
ATGGTAGCTAATCTTCACTTAACGAAGCAAAGTTTTCAATTTTCAGGAATCATACAACCCGATGTTCAGCTTCTAAAAGTTCTAGAGATGCGCAAAAAAATGTTGCAGAAAGAGCAAGGGATGCTTGTAGAAGATATAAGGAACTGTGGAAACGAAAGCATGAGACTGGCCAATGGCTTGAAATTGAAAAGGCTAAAGCATGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.88

Weight (kDa)

10.01

Isoelectric Point (pI)

30.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 92
AcoI YGGCCR 1 cut(s) 168
AgsI TTSAA 3 cut(s) 38, 181, 187
AluBI AGCT 2 cut(s) 8, 70
AluI AGCT 2 cut(s) 8, 70
Alw26I GTCTC 1 cut(s) 157
AoxI GGCC 1 cut(s) 168
AspLEI GCGC 1 cut(s) 93
BalI TGGCCA 1 cut(s) 170
BarI GAAGNNNNNNTAC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 157
BfaI CTAG 1 cut(s) 83
BmsI GCATC 2 cut(s) 78, 111
Bse1I ACTGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 126
BseNI ACTGG 1 cut(s) 171
BshFI GGCC 1 cut(s) 170
BsmAI GTCTC 1 cut(s) 157
BsnI GGCC 1 cut(s) 170
BspANI GGCC 1 cut(s) 170
BsrI ACTGG 1 cut(s) 171
Bst4CI ACNGT 1 cut(s) 146
BstAPI GCANNNNNTGC 1 cut(s) 121
BstF5I GGATG 1 cut(s) 126
BstHHI GCGC 1 cut(s) 93
BstMAI GTCTC 1 cut(s) 157
BstMWI GCNNNNNNNGC 2 cut(s) 112, 121
BstNSI RCATGY 1 cut(s) 203
BsuRI GGCC 1 cut(s) 170
BtsCI GGATG 1 cut(s) 126
CfoI GCGC 1 cut(s) 93
CviAII CATG 2 cut(s) 160, 200
CviJI RGCY 5 cut(s) 8, 70, 170, 177, 193
CviKI_1 RGCY 5 cut(s) 8, 70, 170, 177, 193
EaeI YGGCCR 1 cut(s) 168
FaeI CATG 2 cut(s) 163, 203
FaiI YATR 4 cut(s) 53, 137, 161, 201
FalI AAGNNNNNCTT 2 cut(s) 108, 140
FatI CATG 2 cut(s) 159, 199
FokI GGATG 1 cut(s) 133
FspBI CTAG 1 cut(s) 83
FspI TGCGCA 1 cut(s) 92
GlaI GCGC 1 cut(s) 92
HaeIII GGCC 1 cut(s) 170
HhaI GCGC 1 cut(s) 93
Hin1II CATG 2 cut(s) 163, 203
Hin6I GCGC 1 cut(s) 91
HinP1I GCGC 1 cut(s) 91
HinfI GANTC 1 cut(s) 48
Hpy188III TCNNGA 2 cut(s) 45, 83
HpyCH4III ACNGT 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 2 cut(s) 112, 121
Hsp92II CATG 2 cut(s) 163, 203
HspAI GCGC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 30, 152
LweI GCATC 2 cut(s) 78, 111
MaeI CTAG 1 cut(s) 83
MboII GAAGA 2 cut(s) 5, 143
MlsI TGGCCA 1 cut(s) 170
MluCI AATT 2 cut(s) 38, 182
MluNI TGGCCA 1 cut(s) 170
Mox20I TGGCCA 1 cut(s) 170
MscI TGGCCA 1 cut(s) 170
MseI TTAA 1 cut(s) 20
Msp20I TGGCCA 1 cut(s) 170
MwoI GCNNNNNNNGC 2 cut(s) 112, 121
NlaIII CATG 2 cut(s) 163, 203
NsbI TGCGCA 1 cut(s) 92
NspI RCATGY 1 cut(s) 203
PfeI GAWTC 1 cut(s) 48
SaqAI TTAA 1 cut(s) 20
SetI ASST 2 cut(s) 10, 72
SfaNI GCATC 2 cut(s) 78, 111
SgeI CNNG 8 cut(s) 57, 71, 95, 128, 137, 172, 179, 190
Sse9I AATT 2 cut(s) 38, 182
SspMI CTAG 1 cut(s) 83
TaaI ACNGT 1 cut(s) 146
TasI AATT 2 cut(s) 38, 182
TfiI GAWTC 1 cut(s) 48
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
XbaI TCTAGA 1 cut(s) 82
XceI RCATGY 1 cut(s) 203
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.