RchiOBHm_Chr3g0486791

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
33736970 .. 33740597
3628 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45126

Sequence Viewer

Length: 129 bp
ATGTCTAACCGAGCAGGCTTCTCTGCCATGAATGCATCGGGCATAGTGCTTTTAAATATGACCACCAAGCCAAATGAGTTGGCAGAGAATAATGGAAAAGCTACTTATGCAGGTTCTACAAGGTCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.38

Weight (kDa)

9.69

Isoelectric Point (pI)

24.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 101
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
BfuAI ACCTGC 1 cut(s) 101
BmsI GCATC 1 cut(s) 44
BsmI GAATGC 1 cut(s) 37
BspMI ACCTGC 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 16
BstMWI GCNNNNNNNGC 2 cut(s) 32, 107
BveI ACCTGC 1 cut(s) 101
Cac8I GCNNGC 1 cut(s) 16
CviAII CATG 1 cut(s) 28
CviJI RGCY 3 cut(s) 18, 70, 101
CviKI_1 RGCY 3 cut(s) 18, 70, 101
DraI TTTAAA 1 cut(s) 54
EcoT22I ATGCAT 1 cut(s) 37
FaeI CATG 1 cut(s) 31
FaiI YATR 4 cut(s) 29, 44, 59, 108
FatI CATG 1 cut(s) 27
Hin1II CATG 1 cut(s) 31
HpyCH4V TGCA 2 cut(s) 35, 110
HpyF10VI GCNNNNNNNGC 2 cut(s) 32, 107
Hsp92II CATG 1 cut(s) 31
LpnPI CCDG 1 cut(s) 96
LweI GCATC 1 cut(s) 44
Mph1103I ATGCAT 1 cut(s) 37
MseI TTAA 1 cut(s) 53
Mva1269I GAATGC 1 cut(s) 37
MwoI GCNNNNNNNGC 2 cut(s) 32, 107
NlaIII CATG 1 cut(s) 31
NsiI ATGCAT 1 cut(s) 37
PctI GAATGC 1 cut(s) 37
SaqAI TTAA 1 cut(s) 53
SetI ASST 3 cut(s) 103, 115, 125
SfaNI GCATC 1 cut(s) 44
SgeI CNNG 6 cut(s) 23, 27, 40, 51, 79, 123
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 44
Zsp2I ATGCAT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.